ID: 1101919917

View in Genome Browser
Species Human (GRCh38)
Location 12:108924105-108924127
Sequence CTGTGTCCTCAGATGGCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2873
Summary {0: 1, 1: 13, 2: 276, 3: 763, 4: 1820}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101919917_1101919919 2 Left 1101919917 12:108924105-108924127 CCTTATGCCATCTGAGGACACAG 0: 1
1: 13
2: 276
3: 763
4: 1820
Right 1101919919 12:108924130-108924152 TTTGCCCCTTTTATCATGTGAGG 0: 2
1: 7
2: 49
3: 257
4: 854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101919917 Original CRISPR CTGTGTCCTCAGATGGCATA AGG (reversed) Intronic
Too many off-targets to display for this crispr