ID: 1101921519

View in Genome Browser
Species Human (GRCh38)
Location 12:108937034-108937056
Sequence ACTGCTTTTAATCACCGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101921519_1101921521 30 Left 1101921519 12:108937034-108937056 CCTGCACGGTGATTAAAAGCAGT 0: 1
1: 0
2: 1
3: 0
4: 81
Right 1101921521 12:108937087-108937109 AGTACGTACAGATGATAACCTGG 0: 1
1: 0
2: 0
3: 3
4: 51
1101921519_1101921520 0 Left 1101921519 12:108937034-108937056 CCTGCACGGTGATTAAAAGCAGT 0: 1
1: 0
2: 1
3: 0
4: 81
Right 1101921520 12:108937057-108937079 CAAGTTAAAGAAAAAGATGAAGG 0: 1
1: 0
2: 4
3: 84
4: 959

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101921519 Original CRISPR ACTGCTTTTAATCACCGTGC AGG (reversed) Intronic
904537736 1:31211121-31211143 ACTGCTATTCAACACTGTGCTGG + Intronic
905566434 1:38968989-38969011 ACTGCTTGTAATGACCCTTCAGG + Intergenic
908808042 1:67951030-67951052 GCTGCTTTTAAACACCTTGGAGG - Intergenic
911776884 1:101825197-101825219 CCTGCCTTTGATCCCCGTGCTGG - Exonic
918765456 1:188476781-188476803 ACTCCTATTCATCACCGTACTGG - Intergenic
921093368 1:211864302-211864324 ACTGCTTTTCAACACCATACTGG - Intergenic
924505214 1:244676580-244676602 ACTTCTGTTAAACACTGTGCTGG - Intronic
1064720932 10:18227709-18227731 GGTGCCTTTAATCACCTTGCTGG - Intronic
1072757958 10:98032974-98032996 AATGCTGATAATTACCGTGCTGG - Intergenic
1076640460 10:131912825-131912847 ACTGTTTCTAATGACAGTGCAGG + Intronic
1089962724 11:122630074-122630096 ACTGCTCTTCATCATAGTGCAGG - Intergenic
1091688441 12:2579901-2579923 ACTGATGTTGATCACCGGGCAGG + Intronic
1094045687 12:26163910-26163932 ACTGCTTTTGCTCACCTTGGTGG - Intronic
1094215251 12:27933888-27933910 ACTGCTTTTAAACATTGTACTGG + Intergenic
1101921519 12:108937034-108937056 ACTGCTTTTAATCACCGTGCAGG - Intronic
1102743043 12:115224796-115224818 AGTGCTTTTCATCATCATGCTGG + Intergenic
1107951276 13:45464689-45464711 ACTGCGCTAAATCACCCTGCCGG - Intergenic
1111308510 13:86448928-86448950 ACTGCTTTTAATAATTGTGTGGG + Intergenic
1117386356 14:55217439-55217461 ACTGCTTTTCATTATCGTACTGG - Intergenic
1122304099 14:100750585-100750607 ATTGGTTTTAATCACAGGGCAGG - Intergenic
1122360509 14:101158546-101158568 ACTGCTTTTCAGCATCATGCTGG - Intergenic
1122585793 14:102805624-102805646 ACTGCATGGAATCACCGAGCTGG - Intronic
1124130357 15:26979369-26979391 ACTGCTGTTCAACACAGTGCTGG - Intronic
1125901011 15:43347319-43347341 ACTGCTTTTAATGACACAGCTGG - Intronic
1126310997 15:47316426-47316448 ACTGCTTTTAAACACTATACTGG - Intronic
1128831957 15:70777619-70777641 ACTGCTGCTAATCAGTGTGCTGG + Intergenic
1131964254 15:97822784-97822806 ACTCCTTTTAAACACCATACTGG - Intergenic
1137350908 16:47713242-47713264 ACTGCATTTCATCACAGTGAGGG - Intergenic
1138885475 16:61072721-61072743 ACTGCTTTTAACCAAATTGCAGG + Intergenic
1141170475 16:81687501-81687523 ACTGGTTATAAACACAGTGCAGG + Intronic
1142333237 16:89469537-89469559 ACTTCTTTTGAACACCGTACTGG + Intronic
1145085554 17:19936154-19936176 TCTGCTCTTAATCACTTTGCTGG + Intronic
1149999419 17:61424318-61424340 AATGCTTTTAATCAACGCCCTGG - Intergenic
1155718148 18:28972342-28972364 AATGCTTTTTATCATCTTGCAGG + Intergenic
1158251263 18:55489876-55489898 ACTGCTTTTCATCACCGAGCCGG - Intronic
1158816761 18:61108181-61108203 ACTACTTTTACTCACTGTGTGGG - Intergenic
944865989 2:203862575-203862597 CATGCTTTTAATCACTCTGCTGG + Intergenic
1170096553 20:12651606-12651628 ACAGCTTTTAATCAACTTGGAGG + Intergenic
1173231128 20:41199660-41199682 ACTGCATTTAATCACTGAGGGGG - Intronic
1175179890 20:57138466-57138488 ACTGTTTTGAATAACAGTGCAGG - Intergenic
1181912508 22:26251168-26251190 ACTCCTATTAAACACAGTGCTGG - Intronic
951696867 3:25454029-25454051 TCTGCTTTTAATCATCTTTCAGG - Intronic
953066172 3:39473097-39473119 ACTTCTTATAATAACTGTGCAGG + Intronic
953910567 3:46890775-46890797 ACTGGTGTTAGCCACCGTGCCGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
955716876 3:61838505-61838527 CCTGATTTTAATCACCATGTGGG - Intronic
955919970 3:63945321-63945343 ACTGCTTTTAGCTACTGTGCTGG + Intronic
958838298 3:99172057-99172079 ACTGCTTTTCCTCACTGGGCAGG + Intergenic
963964720 3:151353839-151353861 ACTACTTAGAATCACAGTGCTGG + Intronic
965781543 3:172291327-172291349 ACTGCTTTTGAGCACCTTGAAGG - Intronic
965781552 3:172291517-172291539 ACTGCTTTTGAGCACCTTGAAGG - Intronic
967406721 3:189124353-189124375 ATTGCTTTAAATCACCATACAGG - Intronic
975531890 4:75407888-75407910 AATGCTGTTAATCATCCTGCTGG - Intergenic
976988333 4:91330127-91330149 ACTGCTTTTACTCCACGTACAGG + Intronic
977116924 4:93040249-93040271 CCTGCTTTTAATGACTATGCAGG - Intronic
985143461 4:186867034-186867056 ACTGCTTTTATTCACAATGAAGG + Intergenic
996592862 5:125167300-125167322 ACTGCTTTTCAACATCGTACTGG + Intergenic
999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG + Exonic
1010254601 6:73743522-73743544 ACTGCTTTTTATAACCTTTCAGG + Intronic
1010496911 6:76544918-76544940 ACTGGTTTTCAACACCGTACTGG - Intergenic
1012530620 6:100231121-100231143 CCTGCTTTGAATCACCAGGCAGG - Intergenic
1012702058 6:102471317-102471339 ACTGCTTTTAAACATTGTTCAGG - Intergenic
1020209190 7:6145612-6145634 ACTGGTTTTAATTGCCATGCTGG + Exonic
1026474485 7:70722996-70723018 ACTGGTTTTAATCAACATTCAGG - Intronic
1026925629 7:74190849-74190871 AATGCTTAAAATCACCCTGCAGG - Intronic
1028094614 7:86744760-86744782 ACTGGTTTTAGCCACCATGCTGG - Intronic
1031214461 7:118872106-118872128 ACTGCTTGTTGTGACCGTGCTGG - Intergenic
1033823516 7:145161948-145161970 AATGCATTTACTCACCGTTCTGG - Intergenic
1036143363 8:6228269-6228291 ACTGGTGTGAGTCACCGTGCCGG - Intergenic
1040965751 8:53079344-53079366 GCTGTTTTTAGTCACTGTGCAGG - Intergenic
1047266404 8:123313726-123313748 TCTGCTTTTAATAGCCATGCAGG - Intergenic
1048270762 8:133026375-133026397 ACTCCTTTTAAACACTGGGCTGG - Intronic
1048341056 8:133538800-133538822 ACTGCTTTTAAGCAATATGCTGG - Intronic
1060780351 9:126407658-126407680 TCTGCCTTTAATCACCGCGAGGG + Intronic
1186276370 X:7943092-7943114 ACTGTTTTTAACAACCTTGCTGG + Intergenic
1188665786 X:32819090-32819112 ACTTCTTTTAATCACAGTCTGGG - Intronic
1189534322 X:41922251-41922273 TCTGCTTTGAGTCACCGGGCTGG - Intronic
1192197662 X:69040192-69040214 ACAGGTTTGAGTCACCGTGCTGG - Intergenic
1193892231 X:87063715-87063737 ACTGGTTTTACTCATCCTGCTGG - Intergenic
1194369374 X:93052752-93052774 ACTGCTTTTAAACATCATCCTGG - Intergenic
1197442524 X:126509689-126509711 ACTACGTTTGATCACTGTGCTGG + Intergenic
1198324920 X:135560436-135560458 ACTGCCATTAAACACAGTGCTGG - Intronic
1200677564 Y:6168979-6169001 ACTGCTTTTAAACATCATCCTGG - Intergenic