ID: 1101921841

View in Genome Browser
Species Human (GRCh38)
Location 12:108939310-108939332
Sequence GGGGCTGTTTTCAGAGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101921841 Original CRISPR GGGGCTGTTTTCAGAGTTCC AGG Intronic
900531564 1:3156225-3156247 GGGGCTGTCTGCAGGGCTCCCGG + Intronic
900715891 1:4143452-4143474 GATGCTGTTTTCACAGTTCATGG + Intergenic
900718714 1:4161406-4161428 GGTGCTGTTGTCCGGGTTCCGGG + Intergenic
900919429 1:5661366-5661388 GGGGCTGTCTTGACAGTGCCTGG - Intergenic
902329309 1:15723345-15723367 GGGACTTTTTCCAGATTTCCGGG - Intronic
902359952 1:15936993-15937015 GGAGCTGCTTTCGGGGTTCCAGG - Intronic
902576264 1:17379679-17379701 GGGCTTGTTTTGTGAGTTCCTGG + Intronic
902776295 1:18676878-18676900 GGGGCTGTTCTTTGAGATCCAGG + Intronic
904881184 1:33698399-33698421 GGGGCTTTTGCCTGAGTTCCAGG - Intronic
904888784 1:33762237-33762259 GGGTCTGTTTTCACAGCTGCTGG - Intronic
912323284 1:108734636-108734658 GGGGCTGTTCTCATTGTCCCTGG + Intronic
912382812 1:109256441-109256463 GGGTCTGCTTTCAGCCTTCCCGG + Intronic
912510398 1:110185765-110185787 GGGGCTCTTTCCAGGATTCCTGG - Intronic
915716188 1:157947310-157947332 GCTGCTGTTTTCAGAATTTCTGG - Intergenic
916174614 1:162027313-162027335 GGGGCTGTTTCAAAAGTGCCAGG + Intergenic
916330637 1:163612373-163612395 TGGGATGTTTTCACAGGTCCAGG - Intergenic
920349085 1:205325867-205325889 AGGGCTGTTTTCAGTGTTTGCGG - Intergenic
921488803 1:215748531-215748553 GGCTCTGTTTTCAGACCTCCTGG + Intronic
922021365 1:221708176-221708198 GTGGCTGTCTTGATAGTTCCAGG + Intronic
922082789 1:222313851-222313873 AGGGAGGTTTTCAGACTTCCAGG + Intergenic
922809816 1:228409201-228409223 AGGACTGTGTGCAGAGTTCCCGG - Exonic
923142307 1:231171064-231171086 GGGACTGCTTTTAGAGCTCCAGG + Intronic
923547261 1:234931938-234931960 AGGGCTGTTGTAGGAGTTCCTGG - Intergenic
924588287 1:245379143-245379165 GGGAATGTTTTCAGATTTGCAGG - Intronic
1063126238 10:3138831-3138853 GTTGCTGTTTTCCAAGTTCCCGG - Intronic
1064722693 10:18246019-18246041 GGAGCTGTTCTCCGGGTTCCAGG - Intronic
1064756450 10:18575895-18575917 GGCGCTGTCCTTAGAGTTCCGGG + Intronic
1065726659 10:28673905-28673927 GAGGCTGGTCTCAGAATTCCTGG - Intergenic
1066619995 10:37338129-37338151 GGGGCTTTTTTCACATTTCCTGG + Intronic
1070589420 10:77790927-77790949 GGGGCTGTTTTCTAAGTTACAGG - Exonic
1070782049 10:79143328-79143350 GGGTCTGTTTCCAGAGTCTCGGG - Intronic
1070942295 10:80357976-80357998 GGGTCTGCTTACACAGTTCCTGG - Intronic
1071844060 10:89503666-89503688 GTGGGTGTTTTCAGAGTCGCTGG + Intronic
1072331431 10:94357248-94357270 GGTGCAGTTTGCAGAGTTCTTGG + Exonic
1073376972 10:103043849-103043871 AGGCCTGTTTTCAGAGTACAGGG - Intronic
1074833767 10:117269506-117269528 TGGTGTGTGTTCAGAGTTCCTGG + Intronic
1075344770 10:121673951-121673973 GGGACTGTTTTCAAAGGCCCTGG - Intergenic
1076482495 10:130793786-130793808 GGGGATGTTTCCACAGTACCAGG - Intergenic
1076729545 10:132431512-132431534 GGAGCTCTTGTCTGAGTTCCAGG + Intergenic
1076849126 10:133084373-133084395 TGGGCTGTGTTCAGACTGCCCGG + Intronic
1077281507 11:1748182-1748204 GGGGCTGTTCTCGGAGCTGCTGG - Intronic
1077392002 11:2304532-2304554 GGAGCTGTTTCCAAAGTCCCTGG + Intronic
1077411321 11:2405219-2405241 GGGGCTGCTTTCCTAGTCCCAGG - Intronic
1082561164 11:54622645-54622667 GGTGCTGTGTTCAGAGACCCAGG - Intergenic
1082986067 11:59172288-59172310 GGGCCTGTTTGCAGAGAGCCGGG + Intronic
1083254855 11:61489778-61489800 GGGGATGTTCTCAAAGTACCTGG - Exonic
1083298315 11:61727058-61727080 GGGGCTGTTGTCAGAGTCTGGGG + Intronic
1084191241 11:67499939-67499961 GGAGCTGTTCTCAGAGTCTCGGG + Exonic
1090429943 11:126637242-126637264 TGGGCTGATTTCAGAGTAACTGG + Intronic
1092884988 12:12917059-12917081 GGGGTTGATTTCCCAGTTCCTGG - Exonic
1096003524 12:48149472-48149494 GCGAGTGTTTTTAGAGTTCCTGG + Exonic
1096243747 12:49973248-49973270 GGCGCTGTTTGCAGAGTTCCTGG + Exonic
1101921841 12:108939310-108939332 GGGGCTGTTTTCAGAGTTCCAGG + Intronic
1101985180 12:109440438-109440460 GGGGCTGTTGTAAGAGTCCCGGG + Intronic
1102548815 12:113675890-113675912 GGGACTGTTTTAAGAACTCCAGG - Intergenic
1103213250 12:119181911-119181933 CGGTCTGTTTACAGAGTGCCAGG - Intronic
1103731361 12:123029917-123029939 GGGTCTGTTTTCCCAGTTTCTGG - Intronic
1104682450 12:130761035-130761057 GGGGCTCTTTCCAGAGGTCAAGG - Intergenic
1105902047 13:24764032-24764054 GGGGCTGTTTTCCGTTATCCTGG - Intergenic
1107811719 13:44206813-44206835 GGGGCTTTTTTCAGGGGTCAGGG + Intergenic
1107926554 13:45268714-45268736 TCGTCTGTTTTCAGAGTTTCTGG - Intronic
1108802245 13:54113580-54113602 GGTGCTGTTTTCATAATTCAAGG + Intergenic
1110692660 13:78449721-78449743 GGTGCTTTTTTCAGATTTACTGG + Intergenic
1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG + Intergenic
1115358952 14:32480004-32480026 GGGGCTGATTTAGGATTTCCTGG + Intronic
1117031658 14:51677922-51677944 GGAGCTGATTTCAGGGTGCCAGG + Intronic
1119420875 14:74507246-74507268 AGGGCTGTTTTCACACTTCCAGG + Exonic
1120215211 14:81674734-81674756 ACAGCTGTTTGCAGAGTTCCTGG - Intergenic
1120751047 14:88198715-88198737 GGGGCTGGGTTAACAGTTCCTGG - Intronic
1122462474 14:101906982-101907004 GGGGCTGTGTTCAGATCACCTGG - Intronic
1123012431 14:105355941-105355963 GGGGTTGTGTTCAGGGGTCCAGG + Intronic
1124043497 15:26126221-26126243 GGGGCTGTTTCCCCAGTTCTGGG + Intergenic
1124252728 15:28117555-28117577 GGAGCTGCTTTTGGAGTTCCTGG - Intronic
1125748922 15:42015443-42015465 TGGGCTGTTTTCAGAGCTCAGGG + Intronic
1127628693 15:60805240-60805262 TGGGCTGTTGTCAGAGTGACTGG - Intronic
1129679812 15:77652331-77652353 GGGTCTGTTCCCAGAGTCCCCGG + Intronic
1129905632 15:79185333-79185355 GTGGAGGTTTGCAGAGTTCCAGG - Intergenic
1131389303 15:92034149-92034171 GGGGCTGTATGCAGGGATCCAGG + Intronic
1132394117 15:101459674-101459696 GGAGCTGTGTTCATAGTTGCTGG - Intronic
1132631057 16:917681-917703 GGGGCTGTTTGCAGGGGTGCTGG + Intronic
1136409826 16:30069783-30069805 GGGGCTGTGGTCAGAGACCCAGG - Intronic
1139945125 16:70635590-70635612 GGAGCTGTTTCCAGTGTTCAAGG + Intronic
1141758832 16:86013410-86013432 GTGGCTGCTTTCAGAGGTTCTGG + Intergenic
1142068889 16:88078448-88078470 GCAGCTGTCTTCAGAGCTCCGGG - Intronic
1142321653 16:89387034-89387056 AGGGCTGCTTTCAGACCTCCTGG + Intronic
1143003499 17:3811164-3811186 TGGGCTGTTACCAGAATTCCTGG - Intergenic
1143156201 17:4838168-4838190 GGGGCTGTTTGGAGAGCTCGAGG + Intronic
1143727444 17:8859154-8859176 CTGGCTGTCTTCTGAGTTCCTGG + Intronic
1147511091 17:41069466-41069488 GGGGCTGGTTTGTGATTTCCGGG + Intergenic
1149697948 17:58631421-58631443 GGGGCTTTTTTCTGTGGTCCTGG - Intronic
1153005507 18:495446-495468 GGGGCCGTTTTCAGAGTTGGTGG + Intronic
1155106148 18:22668166-22668188 GGGGGTGCTCTCAGGGTTCCTGG + Intergenic
1157592088 18:48842128-48842150 GTGGCTGTTTTCGAAGCTCCTGG + Intronic
1158480458 18:57817228-57817250 GGTTCTGTCTTCAGACTTCCAGG - Intergenic
1161312839 19:3604339-3604361 GGCGCTGTTTCCAGAGGCCCGGG + Intronic
1161712854 19:5859574-5859596 GAGGCTGTTTTCAGGTGTCCTGG + Intergenic
1166850372 19:45757251-45757273 GGGGCTGTTCTCTGGGGTCCAGG - Exonic
1167166821 19:47804263-47804285 TCGGCTGGTTTCAGAGTCCCGGG + Intronic
1167175015 19:47859501-47859523 TCGGCTGGTTTCAGAGTCCCGGG - Intergenic
1167211268 19:48135627-48135649 GGGGCTGTGGGCAGAGTGCCAGG - Intronic
925867070 2:8237440-8237462 GAGGCTGTATTCAGAGTTCTTGG - Intergenic
925913281 2:8587091-8587113 GGGGCTGTTTTCAGATTTGAAGG - Intergenic
929109379 2:38393554-38393576 TGGGTTGTGTACAGAGTTCCTGG + Intergenic
929236045 2:39606763-39606785 GAGGCTGTTTTCAGAGCTAGGGG + Intergenic
930476393 2:51887955-51887977 GGGGCTGGTTTTCTAGTTCCTGG + Intergenic
932699005 2:73980658-73980680 TGGGCTAATTTCAGAGGTCCTGG + Intergenic
932754255 2:74395053-74395075 GGTGCTGTTGTAAGAGATCCAGG + Intergenic
934740034 2:96713622-96713644 GGAGCTGTTTCCTGAGATCCTGG - Intronic
935026958 2:99286130-99286152 GGGACTCTTTGCAGAGTCCCAGG - Intronic
937062650 2:118991951-118991973 GGCGCTGTTTTAAGAGTTCTGGG + Intronic
937589718 2:123598408-123598430 GAGACTGTTCTCAGAGTTCAGGG - Intergenic
939680952 2:145131203-145131225 GGTGCTGTTTTCATTGTTGCTGG - Intergenic
939959675 2:148555292-148555314 TGGGCTGTTTCCAGAGTACAGGG + Intergenic
942417275 2:175772535-175772557 GTGAGTGTTTTCTGAGTTCCTGG - Intergenic
942540614 2:177011686-177011708 GCAGCTGTTTTCTGAGTTGCTGG + Intergenic
942778405 2:179612750-179612772 GGGGCTGATTTTAGAGCCCCAGG - Intronic
947059298 2:226144636-226144658 GGAGCTGTTTCCAGTGTGCCAGG - Intergenic
947932894 2:233978496-233978518 GGGGCTTTTTTCTTCGTTCCTGG + Intronic
948781107 2:240322470-240322492 GGTCCTGTCTTCAGAGTTCCCGG + Intergenic
948806279 2:240454590-240454612 AGGGCTGTGTGCAGAGCTCCAGG - Intronic
948836612 2:240629058-240629080 GGGGCTGGTCTCAGCCTTCCTGG + Intronic
1170523838 20:17216799-17216821 GTGGCTGTTTTCAGATTTTAAGG - Intergenic
1175160267 20:57003061-57003083 GGGGTTGGTGTCAGAGCTCCGGG + Intergenic
1177138691 21:17334563-17334585 TTGGCTGTTTTCAGATATCCAGG - Intergenic
1178251010 21:31003459-31003481 GGAGCCCTTTTCAGTGTTCCAGG - Intergenic
1178619513 21:34161465-34161487 GGGGCTATTGTCAGAGGTTCTGG + Intergenic
1178675287 21:34626254-34626276 GGAGCAGTTTTCAGGGCTCCTGG - Intergenic
1178707198 21:34886116-34886138 GAGGCTGTTTTCGGAGAGCCAGG - Intronic
1178905389 21:36632123-36632145 GTGGCTTTTTTCAGACTTACAGG - Intergenic
1180731443 22:17985344-17985366 GGCTCTGTTCTCAGAGTTCACGG - Intronic
1183742355 22:39675835-39675857 GGGGCTGTTTTCTGTGTGGCTGG + Intronic
1183780604 22:39996235-39996257 GGGGCTGTTTCCAGGGTGGCTGG + Intronic
1184062409 22:42091395-42091417 GGGCTGGTTTTCAGAGATCCAGG - Intergenic
1184207516 22:43014712-43014734 GGGGCAGTTTTCCGGGGTCCGGG - Intronic
950494045 3:13323269-13323291 TGGGCTGTCTTCAGAGTACCTGG - Intronic
953677211 3:45012349-45012371 GGGACTGCTTCCAGAGGTCCTGG + Intronic
954199671 3:49016786-49016808 GGGGCAGTCATCAGAGTGCCAGG + Exonic
954657391 3:52203653-52203675 GGTGTTGTTTTCAGAGCTACTGG - Intronic
956147531 3:66206181-66206203 TGGGATGTTTTCAGTGTGCCAGG + Intronic
958561421 3:95752282-95752304 TGGGCTGATTTCAGTGGTCCTGG + Intergenic
960470673 3:118061379-118061401 GGGGCTGTTCTGAGAATGCCAGG - Intergenic
960844938 3:121996482-121996504 GAGGCTGTTTTCAGGGATGCAGG - Intronic
961335748 3:126179006-126179028 GGGGCTGTTGTCACAGTCCAGGG + Intronic
961411770 3:126727357-126727379 GGGGCTGTCATCAGAGCTGCCGG + Intronic
961509061 3:127390177-127390199 TGGGCTGTTTTCAGAACACCTGG - Intergenic
962043453 3:131731567-131731589 GAGGCTGTTTTCTGATTTCTCGG + Intronic
966329355 3:178793802-178793824 TGGGCTGTTTTCAGACTCCTTGG - Intronic
966687989 3:182716533-182716555 GGGGTTGATTTAAGGGTTCCTGG + Intergenic
966757864 3:183388363-183388385 GGGTCTGTTCTCTGGGTTCCTGG - Intronic
967864187 3:194176748-194176770 GGAGCTGTTGTCAGAGGTGCGGG + Intergenic
968288613 3:197522420-197522442 GGAGGTGATTTCAGAGTTCACGG - Intronic
968592689 4:1466698-1466720 GTGGCTGTTTCCAAAATTCCTGG + Intergenic
972242802 4:37211630-37211652 AGGCTTATTTTCAGAGTTCCTGG - Intergenic
975443041 4:74434688-74434710 GGGACTGTTTTCAGTGGTACTGG - Intergenic
984368157 4:178825088-178825110 GAGTCTGTTTTCTGAGCTCCTGG - Intergenic
988113877 5:26857591-26857613 GAGGCAGTTTTAAAAGTTCCTGG - Intergenic
988952916 5:36283063-36283085 AGGACTGTTTTCAGTTTTCCTGG - Intronic
992008658 5:72505469-72505491 GGGGCTGTTTTCTGAGCCACTGG + Intronic
993462829 5:88205874-88205896 GGGGCTTTTTTGACATTTCCTGG - Exonic
993851806 5:93019448-93019470 GGAACTGTTTTCAAAGTTCATGG + Intergenic
996144949 5:119962926-119962948 GGGGCTATTTTCAGAGGTGTAGG - Intergenic
997640325 5:135444746-135444768 GGGGCTGTTTCCAGGTCTCCCGG - Exonic
999060098 5:148624587-148624609 GGTGCTGTTTGCAGATTTCCTGG - Intronic
999177468 5:149641326-149641348 GGGGTATTTTTCAGAATTCCCGG - Intergenic
1001173401 5:169442988-169443010 AGGGCTGTTTTCAGAGAAGCTGG + Intergenic
1001205609 5:169759899-169759921 GGGGATGTTTTCAGGGTTTCCGG + Intronic
1001408561 5:171494644-171494666 GTGGTTGTTTTCTGTGTTCCTGG - Intergenic
1003777811 6:9388970-9388992 GGGGCTATTTTCACATTTTCAGG - Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG + Intergenic
1005425925 6:25702285-25702307 GGGGATGGCATCAGAGTTCCAGG - Intergenic
1006699835 6:35963055-35963077 GGGGCTATTGTCAGCTTTCCTGG - Intronic
1006801839 6:36764799-36764821 GGAGCTGTTTGCAGAGAGCCAGG - Intronic
1007157519 6:39759874-39759896 GGGGGTGTTATCAGAGTTTCAGG + Intergenic
1007333822 6:41136764-41136786 GGAGCTGTTAACAAAGTTCCTGG - Intergenic
1010987126 6:82437575-82437597 TGGGCTGTTTTGAGAATTACAGG + Intergenic
1011636762 6:89381908-89381930 GATGCTGTTTACAGACTTCCAGG - Intronic
1014131494 6:117839475-117839497 GGGGGTGCTTTCAGGGTTTCTGG + Intergenic
1016398092 6:143648091-143648113 GGGTCTGTTTTGAGAATTCAGGG + Intronic
1017334400 6:153238252-153238274 GGGGATGTTTTCAGCATCCCTGG - Intergenic
1019390995 7:786941-786963 GGGGTTGGTTTCAGAGTTGGGGG + Intergenic
1019480563 7:1264810-1264832 GGGGCTGCTGGGAGAGTTCCAGG - Intergenic
1019808184 7:3144339-3144361 TGGGCTGCTTTCAGAGCTCTGGG - Intronic
1019885675 7:3902761-3902783 AGAGCTGTTTTCAAAGTTCCTGG + Intronic
1020822668 7:12989553-12989575 GAGGCTGCTATCAGAGTTCAGGG - Intergenic
1021450475 7:20779038-20779060 GGGGCTTTATTCCGAGTTCTAGG + Intergenic
1024320601 7:48063613-48063635 GTGGCTGTTTTCATAGGTACAGG - Intergenic
1024537665 7:50451151-50451173 GGGGTGCTTTTCAAAGTTCCAGG - Intronic
1025839527 7:65132433-65132455 GGGGCAGTTTTCAAAGGTCATGG - Intergenic
1025883539 7:65563532-65563554 GGGGCAGTTTTCAAAGGTCATGG + Intergenic
1025889906 7:65639074-65639096 GGGGCAGTTTTCAAAGGTCATGG - Intergenic
1025934875 7:66027448-66027470 ACTGCTGTTTTCTGAGTTCCAGG - Intergenic
1026623452 7:71971685-71971707 CGGGCTGTTCTCAAAGTCCCAGG - Intronic
1028183913 7:87758364-87758386 GGTAGTATTTTCAGAGTTCCAGG - Intronic
1030995873 7:116357824-116357846 GGGGATGTTTTCCCAGTTTCTGG + Intronic
1034858154 7:154573246-154573268 GGGGCTGCTATCAGAATTGCAGG + Intronic
1035630410 8:1103232-1103254 GGGGGTGTTTGGAGACTTCCAGG + Intergenic
1035756937 8:2041750-2041772 GGGGCTGTTTTCTGAGATTCAGG + Intergenic
1035773177 8:2166216-2166238 GGGTCTGTTTTCAGACTCACTGG - Intergenic
1036190385 8:6664611-6664633 GGGTCAGTTTTGAGAGTTCATGG - Intergenic
1036717463 8:11139557-11139579 GCATCTGTTTTCCGAGTTCCAGG - Intronic
1038032202 8:23652106-23652128 GGGGCTGTGTTCTGAGTTTAGGG + Intergenic
1038406736 8:27327588-27327610 GAGACTGTTCTCAGAGTGCCTGG - Intronic
1039949001 8:42153232-42153254 GGGGCCGGGTTCAGAGTTCGGGG + Intronic
1042667164 8:71219997-71220019 GGGCCTGATTTCAGAGTCCATGG + Intronic
1043989107 8:86730715-86730737 GTGGCTAATTTCAGAGTTGCTGG + Intronic
1044620920 8:94190234-94190256 AGGGCTGGTTCCAGAGTTGCAGG - Intronic
1044944987 8:97381317-97381339 GGGGCTGTTATCAAAATGCCAGG + Intergenic
1049309908 8:141928315-141928337 GGGGCTCTGTTCTGAGCTCCTGG + Intergenic
1051361517 9:16285533-16285555 GGGACTGTTTTCAGAGTTGTGGG - Intergenic
1054963758 9:70998754-70998776 GGTGCTGTAATCCGAGTTCCAGG - Intronic
1056873662 9:90307213-90307235 GGGGCTGTTTTCTGCTTCCCAGG + Intergenic
1057772449 9:97981053-97981075 GGGGCTGTTGTCACAGCGCCTGG - Intergenic
1059553554 9:115254798-115254820 AGGGCTGCATTCAGAGTTACAGG + Intronic
1062139415 9:134947634-134947656 GGGGCGGTGTTCAGAGCACCGGG - Intergenic
1187306393 X:18098950-18098972 GGAGTTGCTGTCAGAGTTCCCGG - Intergenic
1187356293 X:18575268-18575290 TGGGATGTTTTCAGTGTTCTTGG + Intronic
1190007550 X:46755038-46755060 GGGGCTGCTTTCAACCTTCCTGG + Intronic
1192640250 X:72855599-72855621 GGGGCTGTTTTCTAAGTTGTAGG + Intergenic
1192641461 X:72865177-72865199 GGGGCTGTTTTCTAAGTTGTAGG - Intergenic
1194973655 X:100371769-100371791 GGAGCTGTTTTCAGGGTTCCAGG - Intronic
1195178907 X:102338361-102338383 GAGGCTGCTTGCAGTGTTCCTGG - Intergenic
1195457625 X:105086883-105086905 GTTGCTGTTTTCTAAGTTCCTGG - Intronic
1195770712 X:108348003-108348025 GGGGTTGTTTTCTGAGCTCTAGG + Intronic