ID: 1101928220

View in Genome Browser
Species Human (GRCh38)
Location 12:108990953-108990975
Sequence CTGCTCTTCTCGTTCATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101928215_1101928220 9 Left 1101928215 12:108990921-108990943 CCCAGATGCTGCTGGCATTGCTG 0: 1
1: 1
2: 3
3: 60
4: 452
Right 1101928220 12:108990953-108990975 CTGCTCTTCTCGTTCATCAGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
1101928213_1101928220 30 Left 1101928213 12:108990900-108990922 CCTTTACACTTTGAGTGCATTCC 0: 1
1: 0
2: 1
3: 30
4: 161
Right 1101928220 12:108990953-108990975 CTGCTCTTCTCGTTCATCAGAGG 0: 1
1: 0
2: 0
3: 6
4: 104
1101928216_1101928220 8 Left 1101928216 12:108990922-108990944 CCAGATGCTGCTGGCATTGCTGA 0: 1
1: 0
2: 0
3: 32
4: 321
Right 1101928220 12:108990953-108990975 CTGCTCTTCTCGTTCATCAGAGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101928220 Original CRISPR CTGCTCTTCTCGTTCATCAG AGG Intronic
906032642 1:42733642-42733664 CTGCAGTTCTCATTCATTAGAGG + Exonic
909937189 1:81565725-81565747 GTGCTTTTCTGGTCCATCAGGGG - Intronic
911977923 1:104525440-104525462 CTTCTATTCTCTTTCATCACAGG - Intergenic
915865238 1:159492463-159492485 CTGATCTTCTTGTCCCTCAGTGG + Intergenic
920188172 1:204175276-204175298 CTGCTCTCCTCCTTCCTCTGTGG - Intergenic
924555083 1:245111589-245111611 CTTCTCTTCACTTTCATCAAAGG + Intronic
1063710205 10:8469966-8469988 CTGCTGTTCTCACTCATAAGTGG + Intergenic
1066505646 10:36039593-36039615 CTTCTCTTCTTGTGCATAAGGGG + Intergenic
1067853692 10:49771908-49771930 CTGTACTTCTTCTTCATCAGTGG - Intergenic
1068138485 10:52974717-52974739 GTGCTCTTCTGGGTCAACAGAGG + Intergenic
1068956997 10:62827311-62827333 CTGGCCTTCTAGGTCATCAGAGG + Intronic
1069033927 10:63628982-63629004 CTTGTTTTCTCCTTCATCAGTGG - Intergenic
1073726621 10:106239454-106239476 CTGATTTTATCATTCATCAGTGG + Intergenic
1075589046 10:123678321-123678343 CTGCTCATATCATTCTTCAGTGG + Intronic
1075922235 10:126223615-126223637 CTGCTCTTCTCGTACTATAGAGG - Intronic
1077954452 11:7000045-7000067 CTAATCTTCACATTCATCAGAGG - Exonic
1078005690 11:7530754-7530776 CTGCTCCTCTCTTTCTTCAGGGG + Intronic
1078356843 11:10638632-10638654 CATTTCTTCTTGTTCATCAGAGG - Intronic
1083949804 11:65947670-65947692 CTGCACTTCTCCCTCATCGGAGG - Exonic
1091015344 11:132045938-132045960 CTGCTATTCTCGTTCTGCATAGG + Intronic
1091334817 11:134758496-134758518 CTGCTCTCCAGGTTCAGCAGGGG + Intergenic
1095592800 12:43923023-43923045 CTGCTCTGCTCCTCCAGCAGAGG - Intronic
1098392229 12:69981535-69981557 CTGCCCTCCTCCTCCATCAGAGG + Intergenic
1099819166 12:87687963-87687985 CTGTTCTTTACATTCATCAGAGG + Intergenic
1101928220 12:108990953-108990975 CTGCTCTTCTCGTTCATCAGAGG + Intronic
1102968522 12:117147769-117147791 CTGGGCTTCTCCTGCATCAGGGG - Intronic
1105061579 12:133156667-133156689 CTGCCCTTATTGTGCATCAGAGG + Exonic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108328352 13:49358048-49358070 CAGATGTTCTAGTTCATCAGGGG - Intronic
1109793518 13:67279681-67279703 CTCCTCTTCTCCTGCTTCAGGGG + Intergenic
1110552608 13:76825838-76825860 GTGCTCTTCTTGTTCCACAGAGG - Intergenic
1111352315 13:87047207-87047229 CTGCTTTTCTCACTCATAAGTGG + Intergenic
1121529650 14:94643549-94643571 CTGGCCTTCTCCTTCATCATGGG - Intergenic
1123702463 15:22925676-22925698 CAGCTCTTCTCTCTCAGCAGGGG + Intronic
1125937238 15:43648035-43648057 CTGCTCTTCTTGTTGGTAAGCGG + Exonic
1125973735 15:43933228-43933250 CTCCTCTTCTCCTCCACCAGTGG - Intronic
1126256553 15:46633783-46633805 GTGCTCTTGTCTTTCTTCAGTGG + Intergenic
1127764657 15:62173270-62173292 CTACTCTTCTATTTCCTCAGGGG - Intergenic
1127910634 15:63413252-63413274 CTGCCCTTGTCTTTCAGCAGAGG - Intergenic
1134334547 16:13285821-13285843 CTGATTTTCTCTTCCATCAGAGG + Intergenic
1139012380 16:62648647-62648669 GTGCTCTTCTGGGTCAACAGAGG - Intergenic
1139164998 16:64555429-64555451 TTGCTCTTCTTGTACTTCAGTGG + Intergenic
1142319649 16:89372853-89372875 CTGCACCACCCGTTCATCAGTGG + Intronic
1143056392 17:4165314-4165336 CTGCTCTACTCATTCAGAAGTGG + Exonic
1147700174 17:42388635-42388657 CTGCTCTCCTCATTGGTCAGTGG - Intergenic
1148069500 17:44899759-44899781 CTCCTGTTCTGGTTTATCAGGGG + Exonic
1151816037 17:76471916-76471938 GTGCTCTTCCTGTTCATCTGTGG - Exonic
1153773609 18:8434492-8434514 ATGCTCATCTCCTTCAGCAGAGG - Intergenic
1154300556 18:13187643-13187665 CTGCCCTTCTCGCTCCCCAGAGG + Intergenic
1155656243 18:28196106-28196128 CTGCTATTCACATACATCAGAGG + Intergenic
928371771 2:30745077-30745099 TTGCTCCTCTCTTTCATCTGTGG + Intronic
931896018 2:66730439-66730461 CTGCTATTCTATTTCATCTGAGG + Intergenic
934940616 2:98499054-98499076 CTGCTTTCCTAGTTCCTCAGTGG - Intronic
942323144 2:174753532-174753554 CTGCTCTTCTCCTTCTTAACTGG - Exonic
942736096 2:179115172-179115194 CTGCACTTCTCGGTCATCTGGGG - Exonic
945451015 2:209995342-209995364 CTCCTTTTCTCCTTCTTCAGTGG - Exonic
947182711 2:227426322-227426344 ATTCTCTTCTCCTTCATCACTGG + Intergenic
947781108 2:232764278-232764300 CTGGGCTTCATGTTCATCAGCGG + Intronic
1171073452 20:22098631-22098653 CTGCTCTTCCCCTCCACCAGAGG + Intergenic
1177536288 21:22432234-22432256 TTGCACTTCTCTTTCATCACAGG - Intergenic
1182390528 22:29991195-29991217 CAGCTATTCTCTTTCATGAGTGG - Intronic
1182612565 22:31561225-31561247 CTGCTCCTCTCTTTCCTGAGTGG + Intronic
955725806 3:61931403-61931425 CTGCTCTTCTGTTTCATGTGTGG + Intronic
959418472 3:106104827-106104849 CTGCTCTTCTTTTTCTTCATAGG + Intergenic
965183588 3:165435399-165435421 CTGCTCTTCTTTTACATCACAGG - Intergenic
971759256 4:30744065-30744087 TTGCTCTTTTCTTTCCTCAGTGG + Intronic
973047229 4:45549823-45549845 CTGCTCTTCTTCTTCACCATGGG + Intergenic
975434521 4:74335583-74335605 GTGCTCTTCTGGGTCAACAGAGG + Intergenic
975711922 4:77169479-77169501 CTGCTCTTCCCGTCCACAAGTGG + Exonic
983040223 4:162915771-162915793 CTGAGCTTCCTGTTCATCAGTGG - Intergenic
983842113 4:172469897-172469919 CAGCTCTTCTCGTTCACTACTGG - Intronic
986508206 5:8474557-8474579 GTGCTCTTCTGGGTCAACAGAGG + Intergenic
987293631 5:16531088-16531110 CTGCTGTTATCTTTCATCAAGGG - Intronic
995015711 5:107306441-107306463 ATGATTTTCTCCTTCATCAGTGG - Intergenic
997292820 5:132749598-132749620 CTGCTCTACTTGTTCATTTGTGG - Intronic
998232410 5:140369341-140369363 CTTCACTTCTCCTTCACCAGAGG + Intronic
1006790786 6:36699656-36699678 CTGCTCTTCTGGTTGGTCATGGG - Intronic
1007157339 6:39758094-39758116 CTGCTCTTCTCATTCATACAAGG - Intergenic
1008561059 6:52725094-52725116 CAGCCCTTCTCTATCATCAGAGG + Intergenic
1009295228 6:61938942-61938964 CTCCTATTCATGTTCATCAGTGG + Intronic
1010496649 6:76540617-76540639 CTGCTCTTGGAGTTCAGCAGTGG + Intergenic
1010687204 6:78867236-78867258 CTACTCTTCTCCTTCCTCTGAGG + Intergenic
1011425088 6:87219466-87219488 CTGCTTTTCTTGTTGATCAGTGG + Intronic
1014127800 6:117796700-117796722 TTGATCTTCTTGTTCATAAGTGG - Intergenic
1014229693 6:118889504-118889526 CTACTGCTCTCATTCATCAGAGG - Intronic
1016119257 6:140327349-140327371 GTGCTCTTCTGGGTCAACAGAGG + Intergenic
1016760493 6:147730869-147730891 CTGCTCTTATCAGTCACCAGTGG - Intronic
1021783596 7:24130536-24130558 GTGCTCTTCCAGGTCATCAGTGG - Intergenic
1022289955 7:28991207-28991229 CAGCTCTTCTCGCCTATCAGTGG - Intergenic
1028766712 7:94568053-94568075 CTGCTCTTCTTTTAAATCAGAGG - Intergenic
1028848681 7:95512063-95512085 CTGTGCTTCCCCTTCATCAGGGG - Intronic
1031228536 7:119074350-119074372 TGGCTCTTCTCGTTCATCAAGGG - Intergenic
1031399194 7:121311264-121311286 TAGCACTTCTCATTCATCAGAGG + Intergenic
1032880823 7:136088752-136088774 CTGGGCTTCTCCTTCCTCAGAGG + Intergenic
1033120091 7:138659963-138659985 CTGCTCATCTCGTTCCTGTGGGG - Exonic
1035621805 8:1041078-1041100 CTGCTCTCCTCTTTCCTAAGGGG + Intergenic
1036682098 8:10883000-10883022 CTCCTTTTCTGGTTCGTCAGTGG - Intergenic
1038104222 8:24415054-24415076 CTGCATTTCTCGTGCATCAGAGG + Intergenic
1041835018 8:62201927-62201949 CTGCTTTTCTCAGTCATCAATGG + Intergenic
1042888700 8:73582724-73582746 CTGCACTTGGTGTTCATCAGTGG - Intronic
1042994091 8:74674609-74674631 GTGGTCTTCTAGTTCATCAGTGG + Intronic
1045185910 8:99837793-99837815 CTGCTCCTTCCTTTCATCAGAGG - Intronic
1047831300 8:128633384-128633406 CTGCTTTGCTCTTTCATCAATGG - Intergenic
1049544014 8:143221266-143221288 CTGCCCTTCATGTTCATCCGTGG + Intergenic
1052673931 9:31594672-31594694 CTCCTTTTCTCATTCATCAAGGG - Intergenic
1187888278 X:23909071-23909093 CTGCTTTTCTCTTTCTTAAGAGG + Intronic
1188306567 X:28566670-28566692 CTCATCTTCTCATTCATCTGTGG + Intergenic
1191665495 X:63698262-63698284 CTTTTTTTCTCTTTCATCAGTGG - Intronic
1192659799 X:73030319-73030341 CTGATATTCTGGTTCTTCAGTGG - Intergenic
1195034231 X:100956677-100956699 TTGCTCTTCACTTTCATGAGAGG - Intergenic
1196619165 X:117802849-117802871 TTGCTATTCTCTTTAATCAGAGG + Intergenic