ID: 1101929861

View in Genome Browser
Species Human (GRCh38)
Location 12:109005218-109005240
Sequence TCTGGCAAACAGACTGACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101929856_1101929861 4 Left 1101929856 12:109005191-109005213 CCATCGGAGTAGACAAGAGAGCC 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1101929861 12:109005218-109005240 TCTGGCAAACAGACTGACTTGGG 0: 1
1: 0
2: 1
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101929861 Original CRISPR TCTGGCAAACAGACTGACTT GGG Intronic
900605538 1:3522009-3522031 TTTGGCAACAAGAGTGACTTGGG - Intronic
901159531 1:7164291-7164313 TGAGGCAGACAGACTGAATTGGG + Intronic
903596265 1:24497534-24497556 TCTGGCAAACATACTGGCATGGG + Intergenic
905255774 1:36682483-36682505 TCTGGGACCCAGACTGACTGAGG - Intergenic
905962166 1:42052351-42052373 CTTGGCAGACACACTGACTTGGG - Intergenic
909472767 1:76047738-76047760 TCTGGCAAACAGAATAAATCTGG - Intergenic
910192994 1:84613353-84613375 TCTGCCAAACAGATCTACTTTGG + Intergenic
910303139 1:85730507-85730529 CCTGGCCAACAGCCTGAATTCGG + Exonic
910892998 1:92037446-92037468 TTTGACAAACAGCCTTACTTGGG - Intronic
911414862 1:97558478-97558500 ACTGACAAACATACTGACTAGGG + Intronic
911493902 1:98606445-98606467 TCTGGCTGTCAGCCTGACTTGGG + Intergenic
911801034 1:102138340-102138362 TCTTTCTAACAGACTGACCTAGG + Intergenic
912244643 1:107948412-107948434 TCTGGCAAACCAAGTGACCTTGG + Intronic
912759651 1:112355846-112355868 TCTGCCCAACAGAGTGAATTTGG - Intergenic
917536612 1:175878714-175878736 TCTGGCAACCACACTGAGTCAGG + Intergenic
919869394 1:201809065-201809087 TGTGGCAAACAGAGTTATTTTGG + Intronic
924623763 1:245684211-245684233 TCTGCCAAACAAAGTGAATTAGG - Exonic
1064429631 10:15259659-15259681 TCTTACAAGCAGAATGACTTTGG - Intronic
1066300284 10:34090054-34090076 TCAGGCAAGCAGAATGACTGGGG + Intergenic
1068723276 10:60271727-60271749 TCTGGCAAACACACTGCTTTTGG + Intronic
1070617942 10:77983432-77983454 TCTCACAAACAGACCAACTTGGG - Intronic
1073514652 10:104065653-104065675 TCTGGCCAACATACTGTCCTGGG + Intronic
1075663804 10:124216642-124216664 TCTGGCAAACAGGCTTGCTCAGG - Intergenic
1078499608 11:11857844-11857866 GTTGGCAAACAGACTGATTACGG + Intronic
1079398984 11:20090401-20090423 TCTGGCAATCAGAATGGCTTTGG - Intronic
1081238536 11:40676451-40676473 TCAGGCAAACATACAGATTTGGG + Intronic
1081260248 11:40950724-40950746 TCTGGGAAATAAACTTACTTGGG - Intronic
1081624316 11:44639180-44639202 CCTGGCAAAAAGATTGACATAGG + Intergenic
1081956173 11:47096085-47096107 TCTGGTGAACAGACTAATTTGGG + Intronic
1083434398 11:62632748-62632770 GCAGGCAAACAGACAGACTTGGG + Intronic
1083512109 11:63219433-63219455 TGTGGCAAACAAAATGATTTTGG + Intronic
1085757145 11:79211181-79211203 TCTGCTAAACAGACTAAGTTGGG + Intronic
1087260184 11:96002446-96002468 TTTGGCAAATAGAATGTCTTAGG + Intronic
1087333690 11:96815477-96815499 TCTGTCAAACACCCAGACTTGGG - Intergenic
1089017988 11:115182671-115182693 TTTGGCAAAAAGACTGACCTTGG + Intronic
1089018109 11:115183571-115183593 TTTGGCAAAAAGACTGACCTTGG - Intronic
1091526935 12:1312287-1312309 ACAAGCAAACAGACTGACTCTGG - Intronic
1094379931 12:29831645-29831667 TCTGGCAGAAAAAATGACTTAGG - Intergenic
1098150553 12:67541983-67542005 TCATGCAAACAGCTTGACTTAGG + Intergenic
1100459809 12:94788167-94788189 TCTGGTAACCAGCCTGGCTTTGG - Intergenic
1101929861 12:109005218-109005240 TCTGGCAAACAGACTGACTTGGG + Intronic
1102655394 12:114478808-114478830 ACTGGCAAAGTGTCTGACTTGGG + Intergenic
1102877407 12:116458876-116458898 TCAGGGAAACAGACGGACTCAGG - Intergenic
1105412671 13:20184497-20184519 AGTGGAAAATAGACTGACTTTGG + Intergenic
1106966673 13:35079170-35079192 TCTGGCAAAAATATAGACTTTGG - Intronic
1108140826 13:47419292-47419314 TCTGGCAAAGTGAGTGACTCAGG + Intergenic
1110535127 13:76642411-76642433 TCTGGGAAGCAGCCTGACTCTGG + Intergenic
1110576710 13:77065254-77065276 TGTGGCAAACAGACTTTCTCAGG - Intronic
1114874935 14:26704725-26704747 TGTGGAAAACATACTGAATTGGG + Intergenic
1116466519 14:45239707-45239729 TCTGGAAAACAGACTGAAAAAGG + Intronic
1118848800 14:69569293-69569315 TCTGGCTTACTGAGTGACTTTGG - Intergenic
1118862706 14:69677148-69677170 GCTGGCAGACAGACTGACCCAGG - Intronic
1122289732 14:100673980-100674002 TCTGGCACAGAGCCCGACTTGGG + Intergenic
1125079823 15:35659666-35659688 TCTGGAAAACAGGCTCAATTTGG + Intergenic
1125133682 15:36314964-36314986 TCTTGCAAACAGACTCAGATGGG - Intergenic
1126514653 15:49521207-49521229 TCTGGAACACACTCTGACTTTGG + Intronic
1126866640 15:52944222-52944244 TCTCTAAACCAGACTGACTTGGG + Intergenic
1126890948 15:53203644-53203666 TCTGGCAAACTGCCTGGCTGTGG - Intergenic
1128251080 15:66164859-66164881 ACTGGCAAACAGATGGACCTGGG - Intronic
1129739707 15:77984393-77984415 TCTGGCAGAGAGAGTGTCTTTGG + Intronic
1135894215 16:26383901-26383923 TATTGAAAACAGACTGAATTGGG - Intergenic
1136987375 16:35121246-35121268 TCTGGCAACCAGCTTGCCTTTGG + Intergenic
1137345131 16:47650522-47650544 TCTGTCAAACAGAATGAGGTAGG - Exonic
1139009041 16:62610089-62610111 TCTGGGAAACAGAAGGAATTGGG - Intergenic
1139500108 16:67356105-67356127 ACTGGCAAAAAGAGTGAGTTAGG - Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1144428431 17:15168041-15168063 TCTGGAAGACAGAATGACTGGGG + Intergenic
1145233295 17:21190648-21190670 CCAGGCAGACAGACTCACTTTGG + Intronic
1145898282 17:28473561-28473583 TCTGGCAATCAGAGTGTTTTTGG - Exonic
1151057612 17:71051751-71051773 TCTGGAAAACAGGCTGAGATGGG + Intergenic
1151864493 17:76791739-76791761 TCTGGCAAACCCTTTGACTTAGG + Intergenic
1154371058 18:13763583-13763605 TTTAGCAAAGTGACTGACTTAGG - Exonic
1155485648 18:26338950-26338972 TCTTAAAAACAGACTGCCTTTGG + Intronic
1156395606 18:36697007-36697029 TCTGACAAAGAGAATCACTTAGG - Intronic
1156731477 18:40198450-40198472 TCTATCAAAGAGACTAACTTTGG - Intergenic
1162354863 19:10176429-10176451 TGTGGCAAACAGACAGCGTTTGG - Intronic
1163541301 19:17912425-17912447 TCTGTCAAAGAAACTGGCTTGGG + Intergenic
929053447 2:37856770-37856792 TCGGGCAGGCAGACTGAGTTTGG - Intergenic
929824192 2:45297412-45297434 CCTGGAAAGCAGACAGACTTGGG + Intergenic
930247478 2:48999821-48999843 TTTCCCAAACATACTGACTTTGG + Intronic
930421277 2:51156322-51156344 TCTGTCAAACACACTGAATTGGG - Intergenic
930873638 2:56190842-56190864 TGTGGAAAACAGACTGACTGGGG - Intronic
933387695 2:81632442-81632464 TCAGGCAAACAGAGAGGCTTGGG - Intergenic
933602650 2:84348572-84348594 TCTGGCAGAAAGAATGACATGGG - Intergenic
935926465 2:108074848-108074870 TGTGGCAAACACTTTGACTTTGG - Intergenic
936082138 2:109439544-109439566 TTTGTCAAACTGCCTGACTTTGG - Intronic
936784460 2:116077127-116077149 AATGGGTAACAGACTGACTTTGG + Intergenic
937458614 2:122066216-122066238 TCTGGTAAACTGAATGGCTTTGG + Intergenic
938143233 2:128813059-128813081 TCTGACAACCAGACTGGCTCTGG + Intergenic
938418365 2:131123403-131123425 TCTGGAGGACAGCCTGACTTGGG + Intronic
939468299 2:142586119-142586141 GCAGGCAAACAGGCTGAATTTGG + Intergenic
940892471 2:159048232-159048254 TCTGGCAAGTAGATTGGCTTTGG + Intronic
941827998 2:169921177-169921199 TATGGCAAAGATACTGAGTTTGG + Intronic
943141616 2:183990218-183990240 TCAGGCAAATAGAATGAATTAGG + Intergenic
945669361 2:212784787-212784809 ACTGGGAAACAGAATGAATTTGG + Intergenic
946592410 2:221265033-221265055 TATGGAAAACATACTGATTTGGG - Intergenic
1170158818 20:13292404-13292426 TCCCGCAAGCAGACTCACTTCGG - Exonic
1170212347 20:13858033-13858055 TGGGGCAAACAGACTGGATTTGG + Intronic
1170368676 20:15624554-15624576 TATGGCCCACAGACTGAATTAGG + Intronic
1174950116 20:55033566-55033588 TCTGGAAAGCACACTGATTTTGG + Intergenic
1177417064 21:20807721-20807743 TCTGGTAAACACACAGCCTTGGG + Intergenic
1181093379 22:20489514-20489536 TTTGGGAAACAGACTGACCTGGG + Intronic
1183090325 22:35518087-35518109 CCTGGGAAACAGACAGAGTTGGG + Intergenic
1184415673 22:44350560-44350582 TCTGAACCACAGACTGACTTAGG - Intergenic
949217765 3:1590609-1590631 TCTGGCAAACAAACGAACATAGG + Intergenic
951233675 3:20209899-20209921 TCTGGGAAGCAGTGTGACTTTGG - Intergenic
954706765 3:52485080-52485102 TCTGGGAAACAGTCTCACTCTGG + Intronic
956161245 3:66355414-66355436 TATGGTATACAGGCTGACTTGGG - Intronic
956715929 3:72079982-72080004 TCTCCTAAAAAGACTGACTTTGG + Intergenic
957873999 3:86121357-86121379 TGTGACTAACAGACTAACTTGGG - Intergenic
960325136 3:116286196-116286218 TCTGGCAGACATCCTGCCTTGGG + Intronic
961985839 3:131133506-131133528 AATGGCAAACAGAATGATTTTGG - Intronic
963324604 3:143848386-143848408 TCAGGCAGTCAGACTGTCTTAGG - Exonic
963750252 3:149170603-149170625 TCTGGAATCCAGACAGACTTGGG - Intronic
966293740 3:178392651-178392673 TAAGGCAAAAACACTGACTTAGG - Intergenic
970133584 4:12897401-12897423 TCTTACAAGAAGACTGACTTGGG + Intergenic
970554802 4:17220408-17220430 TTTGGGAATCAGACAGACTTGGG + Intergenic
971934835 4:33134297-33134319 TCTTGCCAGCAGACTGCCTTTGG + Intergenic
972213902 4:36873175-36873197 TCTGGCAAACACACAGGCTTTGG - Intergenic
973728642 4:53802031-53802053 TCTGGCAACCAGACTGGACTTGG - Intronic
973936635 4:55853464-55853486 TGTGGCACAGAAACTGACTTGGG - Intergenic
974078035 4:57185399-57185421 GCTGGCAATCAGACTGCCTTTGG + Intergenic
974352325 4:60765154-60765176 TCTGGAAAACCAACTGATTTTGG - Intergenic
976408395 4:84685093-84685115 TGTGACAAACAGACTATCTTAGG - Intronic
983160078 4:164402386-164402408 TGTGGCAAAGTGACTGGCTTTGG - Intergenic
983343118 4:166491653-166491675 TCTGGCTTACAGTCTGACTGAGG + Intergenic
984392385 4:179152533-179152555 TCTTGCAACAAGACTGAGTTCGG - Intergenic
984950097 4:185001737-185001759 TCTGCCCAACAGGCTGGCTTAGG - Intergenic
984987056 4:185341558-185341580 TCTGGGAAACATACTGACTTCGG - Intronic
993285286 5:85988349-85988371 TTTTGCAAAGAGACTGTCTTTGG - Intergenic
994773523 5:104014208-104014230 TCTGCCAATCAGACATACTTAGG - Intergenic
995911459 5:117192807-117192829 CTTTGAAAACAGACTGACTTGGG + Intergenic
996399559 5:123046657-123046679 GCTTGAAAACAGGCTGACTTTGG - Intergenic
996500380 5:124209892-124209914 TCTGGCAAACCTGCTGTCTTTGG - Intergenic
996588056 5:125113261-125113283 TCTGGAAAACACACTGGCTTTGG - Intergenic
998539474 5:142966466-142966488 AATTGCAAACAGAATGACTTGGG + Intronic
999114614 5:149151694-149151716 TGTGGCAAACAGACTGGCTGTGG - Intronic
1000171018 5:158703231-158703253 TCTGGAAAACAGACACAGTTAGG + Intronic
1000485555 5:161838819-161838841 TATGGCTGTCAGACTGACTTAGG + Intergenic
1003080130 6:3015122-3015144 TCTGGAAGTCAGACTGAGTTCGG - Intronic
1003731545 6:8830058-8830080 ACTTGGAAACAGACTGAGTTGGG + Intergenic
1004981312 6:21027873-21027895 TCTGGAAAACAGAATCATTTGGG + Intronic
1005227053 6:23655280-23655302 TCAGAGAAAAAGACTGACTTTGG - Intergenic
1006627658 6:35408894-35408916 TCTGAACAACACACTGACTTTGG - Intronic
1008500312 6:52174450-52174472 TTTGGCAAACAGATTTAATTAGG - Intergenic
1008625164 6:53308643-53308665 TCTGGGAAACAGCCTGCTTTGGG + Intronic
1008824029 6:55669303-55669325 TTTGGCAATTAAACTGACTTTGG + Intergenic
1009532308 6:64834049-64834071 TCTGACATAAAGACTGATTTAGG + Intronic
1010341606 6:74759948-74759970 TCTGGTAAACACCCAGACTTGGG - Intergenic
1012642526 6:101637349-101637371 TCGGGCAAAGATACTGAGTTTGG - Intronic
1015720138 6:136232918-136232940 TCTGTCAAATATACAGACTTTGG - Intronic
1016279043 6:142392584-142392606 TTTTCCAAACAGACAGACTTGGG + Intronic
1016427373 6:143948965-143948987 TCTTACAAACAAATTGACTTAGG - Intronic
1017115476 6:150972297-150972319 TCTTGCAAACTGAGTGACATTGG + Intronic
1018798185 6:167203297-167203319 TTTTGCAAACAGAATGACTAAGG + Intergenic
1018814528 6:167320879-167320901 TTTTGCAAACAGAATGACTAAGG - Intergenic
1019714492 7:2532084-2532106 CCTGGCACAGGGACTGACTTAGG + Intergenic
1021100368 7:16582081-16582103 TCTGGCTAACAGTCTGGGTTTGG + Intergenic
1022200800 7:28115119-28115141 TCTGGCAGACATGCTGACTGTGG + Intronic
1024915174 7:54491127-54491149 TCAGGCAAACACCCTGACTCAGG - Intergenic
1026616176 7:71906749-71906771 TCTGGCATCCAGACAGAGTTAGG + Intronic
1027703494 7:81499385-81499407 TCTTGCAAGAAGCCTGACTTTGG + Intergenic
1027926692 7:84474334-84474356 TCTGGGAAACAACCTGTCTTAGG - Intronic
1028126892 7:87123282-87123304 TCTGTAAAACAGACTTACTAAGG + Intergenic
1028631585 7:92940427-92940449 GCTGGGAAACAGACTGCCTGTGG + Intergenic
1029462409 7:100703697-100703719 ACTGACAAATACACTGACTTGGG - Intergenic
1031576475 7:123421110-123421132 TCTGTCACCCAGGCTGACTTTGG - Intergenic
1036507830 8:9371782-9371804 TCTTGCAAACAGATTTCCTTTGG - Intergenic
1039676006 8:39667856-39667878 TTTGGCAAACTCACGGACTTGGG + Intronic
1043513151 8:80969891-80969913 TATAGCAAACTGCCTGACTTTGG - Exonic
1044337916 8:91010379-91010401 TAAGGCTAACAGACTGACATAGG + Intronic
1044353113 8:91189800-91189822 TCTGGGAATCAGAGTGACTTAGG - Intronic
1049948906 9:625369-625391 ACTGGCTAACAGCCTGACTGAGG + Intronic
1050490937 9:6187131-6187153 TCTTGGAATCAGGCTGACTTGGG + Intergenic
1055355436 9:75432454-75432476 TCTGGCAGACAGATTGGATTGGG + Intergenic
1056999812 9:91497302-91497324 CCTGGCCACCAGACTGTCTTGGG - Intergenic
1060276799 9:122188602-122188624 TCAGGCCAACAGAGTGACCTTGG + Intronic
1060609625 9:124951178-124951200 TCTGGCATAGAGACTAATTTGGG - Intronic
1061528938 9:131194703-131194725 TCTGTCAAAATGACTGAGTTAGG + Intronic
1186342665 X:8660430-8660452 TCTGGCAAGCTGGCTGACCTTGG - Intronic
1186520854 X:10205558-10205580 TCTGGCAAACTGACTATTTTGGG - Intronic
1187285819 X:17902771-17902793 TCTGTCAAACTGCCTGCCTTTGG - Intergenic
1187571609 X:20509392-20509414 TTTGGCAGACAAACTCACTTGGG + Intergenic
1188102478 X:26106812-26106834 TCTGGCCAACATTCTGGCTTTGG + Intergenic
1189069932 X:37852571-37852593 TCTGGTAAACAGTCTTGCTTTGG + Intronic
1189250509 X:39597751-39597773 TATGGGAAACACACAGACTTGGG + Intergenic
1191128079 X:56979190-56979212 TCTGGCAAACATAGTAATTTTGG + Intronic
1194380521 X:93185370-93185392 CCTGGCCAACACACTGATTTTGG - Intergenic
1194663262 X:96649277-96649299 TCTGACAAATAGAATCACTTGGG - Intergenic
1195589997 X:106612988-106613010 TCTGGCAAACGTACTGATGTGGG + Intronic
1198709525 X:139486002-139486024 GATGGCAAACATAGTGACTTGGG + Intergenic