ID: 1101932110

View in Genome Browser
Species Human (GRCh38)
Location 12:109023193-109023215
Sequence CCCACCTGACACCAGGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101932110 Original CRISPR CCCACCTGACACCAGGATTG AGG (reversed) Intronic
900423247 1:2564731-2564753 CCCACCTGCCCCCGGGACTGTGG - Intronic
900474241 1:2868854-2868876 CCCATCTGACCCCAGGAGTCAGG - Intergenic
900798046 1:4721227-4721249 CTCTCCTGACTCCAGGACTGTGG + Intronic
901692735 1:10984164-10984186 CCCTGCTGACACCTGGATTTTGG - Intergenic
903020891 1:20393292-20393314 CTCCACTGACTCCAGGATTGGGG - Intergenic
904159139 1:28509737-28509759 CCCACCTGAGACTAGGTTTCAGG - Intronic
904975649 1:34454217-34454239 CCCACCTGACACCTTAACTGTGG - Intergenic
908936378 1:69382327-69382349 CTCACCTTCCACCATGATTGTGG - Intergenic
909979556 1:82082510-82082532 CCCTCGTGACTCTAGGATTGAGG + Intergenic
911089945 1:94010321-94010343 CCCACCTTCCTCCAGGAGTGGGG + Intronic
912861779 1:113219849-113219871 CCCACCTCCCACCAGGCCTGTGG - Intergenic
912902891 1:113671819-113671841 CCCACCTGTCCCCAGGTATGTGG - Exonic
912947885 1:114099817-114099839 CCCACCTGACAACATAATTTTGG + Intronic
915068697 1:153247410-153247432 CACACCGGACAGCAGGATTGTGG + Intergenic
916767261 1:167873388-167873410 CTCTGCTGACACCAAGATTGTGG + Intronic
919067490 1:192711862-192711884 CCCAACTAACACCTTGATTGTGG + Intergenic
919940974 1:202285929-202285951 GCCACCAGACACCAGAAGTGAGG - Intronic
921315075 1:213882719-213882741 TCCCCCTGACACCAGCATGGGGG + Intergenic
922482164 1:225946503-225946525 CCCACCTTCCACCAGGTCTGGGG + Intergenic
922895364 1:229096097-229096119 CCCTGCTGACACCTGGATTTTGG - Intergenic
922927772 1:229364638-229364660 GCCACCTGACACCAGGACAAGGG - Intergenic
923933170 1:238726737-238726759 CCTTCCTGACACCAGGAGTAAGG + Intergenic
1063687018 10:8246709-8246731 CCCTGCTGACACCGTGATTGTGG - Intergenic
1063829892 10:9940631-9940653 CCCACCTGGCAGCAGCAATGGGG - Intergenic
1068784859 10:60960884-60960906 CAGAGCTGACAGCAGGATTGTGG + Intronic
1068835773 10:61551777-61551799 CCCCACTGACACCCAGATTGGGG - Intergenic
1072682267 10:97516119-97516141 TCCTGCTGACACCAGGCTTGGGG - Intronic
1075660069 10:124187264-124187286 CCTAACTGACACCAGCACTGTGG - Intergenic
1081807020 11:45896380-45896402 CCCACCTGGCACCCTGACTGGGG + Intronic
1084164396 11:67368323-67368345 CCCACCTAACACCAAGAACGGGG - Intronic
1084510576 11:69601111-69601133 CCCACCAGGCCCCAGGACTGTGG + Intergenic
1085278669 11:75316029-75316051 CCCACCTGTAACCAGCTTTGAGG - Intronic
1088258466 11:107923149-107923171 CCCCACTGACACCTGGATTTTGG + Intronic
1093758581 12:22880473-22880495 TCCACCTGACAATAGGAATGAGG + Intergenic
1094470682 12:30798421-30798443 CCCATCAGACACCAGTATTTGGG + Intergenic
1095610371 12:44121013-44121035 CTCACCTTCCACCATGATTGTGG - Intronic
1096863712 12:54549026-54549048 CCCACCTGTCTCCAAGACTGTGG - Intergenic
1097296081 12:57964553-57964575 CCCACCTGCCACAAGGATAGGGG - Intergenic
1097700006 12:62810240-62810262 CCTACCCTACTCCAGGATTGGGG + Intronic
1100072579 12:90738023-90738045 CCCACCCAACAGCAGGAATGTGG + Intergenic
1100204943 12:92338853-92338875 CCCAAAGGACACCAGGAATGTGG - Intergenic
1101932110 12:109023193-109023215 CCCACCTGACACCAGGATTGAGG - Intronic
1102233619 12:111280453-111280475 CCCTACTGACACCTGGATTTTGG + Intronic
1104182279 12:126393597-126393619 TCCACCTGCCACTTGGATTGTGG - Intergenic
1104972349 12:132537674-132537696 CCCAACTGTCACAAAGATTGGGG - Intronic
1105521021 13:21131017-21131039 CCCACCGGACACCAGCACTTTGG + Intergenic
1108574076 13:51776823-51776845 CCCACGTGACAGCCGGAGTGGGG + Intronic
1109869561 13:68315756-68315778 GCCACCTGAGAGCAGGATAGAGG + Intergenic
1110922854 13:81110842-81110864 CCCTCCCCACACCAGGCTTGGGG + Intergenic
1111202918 13:84962402-84962424 CACAGCAGGCACCAGGATTGAGG + Intergenic
1121709353 14:96026187-96026209 CCCTGCTGACATCATGATTGGGG - Intergenic
1121711883 14:96044607-96044629 CCCTGCTGACACCTGGATTGTGG - Intronic
1122346943 14:101066640-101066662 CCCACCCGCCTCCAGGATGGAGG - Intergenic
1124254937 15:28132590-28132612 CCCATCTGACAGCAGCAGTGAGG + Intronic
1126318717 15:47398729-47398751 CTCACCTGACACCAGGACAAAGG - Intronic
1126559380 15:50026729-50026751 GCCTCCTGACACCAGGCTAGTGG + Intronic
1126613310 15:50551419-50551441 AACACCTGACTTCAGGATTGGGG - Intergenic
1127692946 15:61415479-61415501 CCCACCAGACCCCAGAATGGTGG - Intergenic
1128027120 15:64447431-64447453 ATCACCTGAGAGCAGGATTGAGG - Intronic
1128756133 15:70185285-70185307 CCCAGCTGACAGCAGGCTTATGG - Intergenic
1129329339 15:74819009-74819031 CTCACATGAGACCAGGAGTGCGG + Intronic
1130652627 15:85770733-85770755 CCCAGCTGACGCCAGGATCCTGG + Intronic
1130914093 15:88291187-88291209 ACCACCCGACACAAGGATGGGGG - Intergenic
1130965393 15:88693909-88693931 TCCACCTCACACAAGGATTGTGG - Intergenic
1131263875 15:90904304-90904326 CCCACCCGACACCAGAATGGTGG + Exonic
1131714735 15:95095975-95095997 TCCACCTGACCACAGGTTTGAGG - Intergenic
1132621168 16:868885-868907 CCCAGCAGACACCTGGATTTGGG + Intronic
1133388251 16:5388074-5388096 CCCTCCTGACACCTTGATTATGG + Intergenic
1133741910 16:8658285-8658307 CCCTGCTGACACCTTGATTGCGG + Intergenic
1139532420 16:67548905-67548927 CCCACATGACAGCAGGGTAGGGG - Intergenic
1139714934 16:68805457-68805479 CCTTGCTGACACCAGGACTGTGG - Intronic
1140237267 16:73170873-73170895 CCCAGCTGTCCCCAGGCTTGTGG + Intergenic
1141794113 16:86258159-86258181 CCCACCTCACAGCACTATTGTGG + Intergenic
1142171148 16:88623501-88623523 CCCACCAAACACCAGCCTTGCGG + Intronic
1142183038 16:88680893-88680915 CCCTGCTGACACCTGGATTTTGG + Intronic
1142698224 17:1645069-1645091 CCCTCCTGATACCAGGAGTCAGG - Intronic
1143504630 17:7356824-7356846 GCCATCTGACACTGGGATTGTGG - Exonic
1144671050 17:17132732-17132754 CCTCCCTGACCCCAGGATGGAGG - Intronic
1144753422 17:17665702-17665724 CCCACCAGCCAGCAGGATAGGGG + Intergenic
1146843608 17:36170325-36170347 CCCAGGTGACACCAGGAGTCCGG + Intronic
1146864705 17:36330112-36330134 CCCAGGTGACACCAGGAGTCCGG - Intronic
1146871821 17:36382174-36382196 CCCAGGTGACACCAGGAGTCCGG + Intronic
1146879182 17:36433256-36433278 CCCAGGTGACACCAGGAGTCCGG + Intronic
1146883116 17:36454402-36454424 CCCAGGTGACACCAGGAGTCCGG + Intergenic
1147464877 17:40603303-40603325 CCCACCTGGCCCCAGGCTTCTGG + Intergenic
1147945998 17:44080494-44080516 CCAACCTGGCACCAGAGTTGGGG + Exonic
1148202208 17:45756613-45756635 CCCACCAATCACCAGGTTTGTGG - Intergenic
1152394667 17:80025308-80025330 CCCAGCTGTCTCCAGGATTAGGG + Intronic
1153387708 18:4516934-4516956 CCCTCCTGACACCTTGATTTTGG + Intergenic
1156019472 18:32583225-32583247 CCCAGGTGAGACCAGGAGTGTGG + Intergenic
1156869909 18:41933727-41933749 TCCTCCTGACACCAGGAGAGGGG + Intergenic
1157755077 18:50210506-50210528 CCCAGCTGACACCTTGATTTTGG - Intergenic
1159173889 18:64809888-64809910 CCCGACTGACACCTGGATTTTGG + Intergenic
1159929291 18:74295107-74295129 CCCAGTTGGCACCAGAATTGGGG - Intergenic
1162191849 19:8953268-8953290 CCTCCCTGACCCCTGGATTGAGG - Exonic
1164423697 19:28120517-28120539 CCCACCTTAGAACAGGATGGTGG + Intergenic
1164694604 19:30233939-30233961 ACACCCTGACACCAGGCTTGGGG + Intronic
1165053454 19:33158157-33158179 CCCACTTCTCACCAGGATAGGGG - Intronic
1167449695 19:49559929-49559951 CTCACGTGACAACAGGATCGTGG + Exonic
926699411 2:15793281-15793303 CCCTCCTGGCACCAGCATGGTGG - Intergenic
927065387 2:19465543-19465565 CCCTGCTGACACCTTGATTGTGG - Intergenic
928459636 2:31458366-31458388 CCCACCTGACTGCAGGGGTGGGG - Intergenic
937841205 2:126526446-126526468 CCCTCCTAACCCCAGAATTGTGG - Intergenic
939664578 2:144935265-144935287 CCTACATTACACCAGGATTATGG - Intergenic
941532086 2:166682666-166682688 CCCTTCTGACACCAGATTTGTGG - Intergenic
942261053 2:174163958-174163980 CCCACCACACATGAGGATTGTGG - Intronic
942421784 2:175815253-175815275 CCCACATGACTACAGGATTCTGG + Intergenic
943483682 2:188454263-188454285 ACCACCAGACTGCAGGATTGGGG - Intronic
944506693 2:200419624-200419646 CCTTCCTGAAGCCAGGATTGGGG + Intronic
947820551 2:233066172-233066194 ACCACCTGACTCCAGGAGTTGGG - Intronic
948342290 2:237263590-237263612 GCCACTCGACATCAGGATTGTGG - Intergenic
948682945 2:239648725-239648747 GCCCACTGACACCAGGATGGAGG - Intergenic
948717793 2:239876397-239876419 CTCACCTGTGACCAGGAGTGAGG - Intergenic
1169001080 20:2168519-2168541 CCAATCTGTCACCAGGTTTGGGG - Intronic
1170907712 20:20530700-20530722 TCCACCTAACACCAGCATTCAGG - Intronic
1171381688 20:24738381-24738403 CCCTCCCGACCCCAGGAGTGAGG + Intergenic
1172117565 20:32581861-32581883 CCCAAATGACACCAGGGGTGAGG + Intronic
1174563962 20:51451432-51451454 CCCACGTGACACCAGTAGTGCGG - Intronic
1175183853 20:57166726-57166748 CCCTGCTGACACCTGGATTTTGG + Intergenic
1175627677 20:60502476-60502498 GCCACCTGAGCCCAGGACTGTGG + Intergenic
1178459146 21:32785728-32785750 CACACCTGACACCTAAATTGTGG - Intergenic
1179514649 21:41898276-41898298 CCCACCTGACTCCACCATTCGGG - Intronic
1179989031 21:44936605-44936627 CCCACTTGAAACCATGATTATGG - Intronic
1180058609 21:45373591-45373613 CCCAGCACACACCAGGTTTGGGG + Intergenic
1183323400 22:37178508-37178530 CAGACCTGGCAGCAGGATTGGGG + Intergenic
1184234704 22:43176859-43176881 CCCCCCTCACCCCAGGATTCTGG + Intronic
1185211258 22:49571785-49571807 CCCACATGACAGCAGTATCGAGG - Intronic
950007142 3:9698628-9698650 CCCACCTGCCAACAGGGGTGGGG - Intronic
952072942 3:29661068-29661090 GCTACCTGCCACGAGGATTGGGG + Intronic
953715320 3:45312525-45312547 GCCTCCTGACATCACGATTGGGG - Intergenic
953890196 3:46745757-46745779 CCCACCAGAGACCAGGAATAAGG + Intronic
954442083 3:50527434-50527456 CCCACCTGGCACCAGGCTTCTGG + Intergenic
954883802 3:53854617-53854639 CCCACATGACACCAGGCTGGGGG + Intronic
955236350 3:57143234-57143256 GCCACCTTACACCAGGATGGAGG + Intronic
956698661 3:71939879-71939901 CCCACCTGAGACACGGAATGGGG + Intergenic
956787731 3:72656204-72656226 CCAACCTGAGACTAGGATTTCGG - Intergenic
961269674 3:125679831-125679853 CCCAGTTGACACCAGGATCCAGG + Intergenic
961457495 3:127031395-127031417 TCCACCTGACCCCAGGTGTGGGG - Intronic
961656130 3:128443044-128443066 CTCACCTGACTCCAGCATTTTGG - Intergenic
965558924 3:170043724-170043746 CCCGCCTGTCACCAGGACAGTGG - Intronic
966436126 3:179885833-179885855 CCCACCTGAAAGCATGATTTTGG + Intronic
967258644 3:187619777-187619799 CGTACCAGACACTAGGATTGTGG - Intergenic
967311149 3:188107487-188107509 CCTACCTTACAGCAGGAGTGGGG - Intergenic
967856971 3:194125423-194125445 ACCACCTGTCACCTGGATGGAGG - Intergenic
971426004 4:26516110-26516132 CTCACCAGACTCCAGGAATGGGG + Intergenic
972673635 4:41238110-41238132 CCCGCCCCACACCAGGCTTGGGG - Intergenic
972684087 4:41335023-41335045 CCCTCCTGACACCTTGATTTTGG + Intergenic
973082487 4:46011700-46011722 TCCACCTCACGCCAGAATTGGGG + Intergenic
973923863 4:55717175-55717197 CCCTGCTGACACCTGGATTTTGG - Intergenic
978237271 4:106474256-106474278 CCCACCTAACTCCAGAAATGTGG - Intergenic
982418824 4:155169667-155169689 CCCAGCTGACACCTTGATTGTGG - Intergenic
982567335 4:157002240-157002262 CCCTGCTGACACCAGGACTTGGG - Intergenic
983648997 4:170020197-170020219 CCCACCTGTCTCGAGGATAGTGG - Intronic
984356742 4:178669772-178669794 CCCTGCTGACACCTTGATTGTGG - Intergenic
985852251 5:2397398-2397420 CCCTCCTGAAACCATGAATGGGG + Intergenic
986109175 5:4693945-4693967 CACACCAGACTCCAGGTTTGAGG + Intergenic
987385542 5:17325822-17325844 CAAACCTGACAGCAGGAATGAGG + Intergenic
989205069 5:38802045-38802067 CCCAACTAACACCTTGATTGCGG - Intergenic
990677272 5:58202033-58202055 CCCTCCTGTCACCAGGGATGTGG + Intergenic
991946490 5:71902835-71902857 CCTACCAGACAGCAGGATGGAGG + Intergenic
994475348 5:100261673-100261695 CCCTCCTGTCACAAGGATAGGGG + Intergenic
999155236 5:149453176-149453198 CCCAGCTGACACCTTGATTTGGG + Intergenic
1000038020 5:157463459-157463481 CCCACCTGCCAACAGGGTTAGGG + Intronic
1001297061 5:170505560-170505582 CCCACCTGTATCCAGGATGGGGG - Intronic
1001784300 5:174398622-174398644 CCCAGCTGACACCTCGATTTTGG + Intergenic
1003566808 6:7229443-7229465 CCAGCCTGACAGCAGCATTGTGG + Exonic
1006521474 6:34573618-34573640 CACACCTGTCCCCAGGAATGAGG + Intergenic
1011421281 6:87176116-87176138 CCCACCTGTCACTAGGTTCGTGG + Intronic
1014099691 6:117498269-117498291 CCAAACAGACACCAGGATTTAGG + Intronic
1017432560 6:154385384-154385406 CTCTCCTGACACCAGGACAGTGG - Intronic
1017832227 6:158140845-158140867 CACTTCTGACACCAGGAGTGTGG - Intronic
1018506882 6:164481443-164481465 CCTTCCTGCCACCAGCATTGAGG - Intergenic
1021399181 7:20189902-20189924 CCCACCTGACACCCTGATCTTGG - Intronic
1024204892 7:47149568-47149590 CCTTCCTGACACCAGGGATGGGG - Intergenic
1024547161 7:50531727-50531749 TCCACCTGACATCATGCTTGAGG - Intronic
1025704287 7:63848458-63848480 CCCACCTTAGACCAGAATTTAGG + Intergenic
1029382348 7:100222124-100222146 CCCACCTCAGACCAGCTTTGGGG + Intronic
1029907576 7:104106992-104107014 CCCTGCTGACACCTGGATTTTGG - Intergenic
1032420981 7:131778785-131778807 CACTCCTGACACCAGGATCCAGG - Intergenic
1034980588 7:155473584-155473606 CCCAGCTGACACCTTGATTTTGG - Intergenic
1035212594 7:157339237-157339259 CCCACCTCAGACCTGGATTTAGG - Intronic
1035255882 7:157627094-157627116 CCCACCTGGGACCTGGACTGTGG - Intronic
1035326021 7:158066650-158066672 CACACCTGACACCTGAGTTGTGG + Intronic
1035327163 7:158072641-158072663 TCCTCCTGACACCAGGACTCCGG - Intronic
1037993578 8:23337731-23337753 CCCTCTTGGCACCAGGAATGGGG + Intronic
1040317566 8:46272963-46272985 CCCACCTGGGACCAGCATGGGGG - Intergenic
1041839745 8:62255450-62255472 CCCAGCTGACACCTGGATTTTGG + Intronic
1042286225 8:67113910-67113932 CCCACCTGCCACCACATTTGAGG - Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1046734575 8:117763357-117763379 CCCTGCTGACACCTGGATTTTGG + Intergenic
1046958908 8:120089158-120089180 CCCTCCTGACACCTGCACTGTGG - Intronic
1048318548 8:133380241-133380263 CCCACCTGGCCCCAGCATTGGGG - Intergenic
1049528227 8:143140156-143140178 CCCACCTGGAACCTGGCTTGCGG - Intergenic
1053214728 9:36260961-36260983 CCCAACTGACACCTTGATTTTGG - Intronic
1053282787 9:36831850-36831872 CCCACGTGACAGCAGAATGGAGG - Intergenic
1056581912 9:87894765-87894787 CCCTACTGACACCGGGAGTGGGG + Intergenic
1062277049 9:135736177-135736199 CCCACCCCACACCAGGGCTGGGG + Intronic
1186396334 X:9212581-9212603 CCCAGCTGACACCTTGCTTGTGG - Intergenic
1187434460 X:19254339-19254361 CCCAGCTGAGAGCAGGAATGAGG + Intergenic
1189299321 X:39941419-39941441 TCCAGCTGACACCTGGTTTGAGG - Intergenic
1189689897 X:43605081-43605103 CACAGCTGACACCTTGATTGAGG + Intergenic
1189943490 X:46152768-46152790 CCCCACTGACACCAGGAGAGGGG + Intergenic
1191183396 X:57585616-57585638 CCCTCCTGACTCCAGGGGTGTGG - Intergenic
1191213984 X:57916778-57916800 CCCTCCTGACTCCAGGGGTGTGG + Intergenic
1191952256 X:66605219-66605241 CCCATCTGTCTACAGGATTGTGG - Exonic
1199474150 X:148227665-148227687 CCCAGCTGACACCTTGATTTTGG - Intergenic