ID: 1101933684

View in Genome Browser
Species Human (GRCh38)
Location 12:109037750-109037772
Sequence CGGCACTCCTTGGCAAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101933684 Original CRISPR CGGCACTCCTTGGCAAAGAC TGG (reversed) Intronic
900830048 1:4959431-4959453 CGTCACCCCTGGGCAAGGACAGG + Intergenic
905037409 1:34927158-34927180 TGGGACTCCTTGCCAAAGAGAGG - Intronic
906108209 1:43307165-43307187 GGGCACTCCTTGGTACAGCCTGG - Exonic
906248980 1:44296726-44296748 AGGTGCTCCTTGGCAAAGATGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1065234206 10:23631099-23631121 CAGAGCTCCTTGGCAAAGGCTGG + Intergenic
1066749281 10:38635973-38635995 CGGCGCTCCTTGGGAAACGCAGG + Intergenic
1066967372 10:42281819-42281841 CGGCGCTCCTTGGGAAACGCAGG - Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1075686261 10:124367219-124367241 CGCCATCCCTTGGCCAAGACTGG + Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081487911 11:43546296-43546318 CGACACTCCTTGGGGAAGAAAGG - Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1086324076 11:85680930-85680952 CGGGACTACCTGGCAAAGGCAGG - Intronic
1090495406 11:127206513-127206535 CTGCACCCCTTGGCAAATTCAGG - Intergenic
1091192915 11:133709121-133709143 CAGCAGTTCTTGGCAATGACAGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1094582585 12:31748159-31748181 AGGCACGAGTTGGCAAAGACTGG + Intergenic
1096660162 12:53119175-53119197 CGGCTCATGTTGGCAAAGACAGG - Exonic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098214408 12:68200399-68200421 CCCCAGTCCTTGGCAAAGCCAGG + Intergenic
1100572880 12:95859255-95859277 GGGCACTCCTAGGAAAAGAAAGG - Intronic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1105574805 13:21640446-21640468 GGGCTCTCCTGGGCAAGGACAGG - Intergenic
1108941821 13:55964399-55964421 CTGCACCCCTTGGCAAATTCAGG - Intergenic
1110568099 13:76976431-76976453 CACCACTCCTTGGCGAAGAAGGG + Intergenic
1115423474 14:33225379-33225401 AGGCACTCTTTGACCAAGACTGG - Intronic
1117714026 14:58562652-58562674 TGGCACTCCGTGGCCAAGATTGG + Intergenic
1118594243 14:67423625-67423647 CGGCAAACCTTGGCACAGTCTGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122070719 14:99203918-99203940 TGGCACTCCTTGGCTCAGAGCGG - Intronic
1122232404 14:100313317-100313339 GGGCACCCCCTGGCAAAGAGGGG - Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1124792000 15:32736574-32736596 CAGAGCTCCTTGGCAGAGACTGG + Exonic
1129778843 15:78255695-78255717 CGGTCCTCATTGGCAAAGAATGG + Intergenic
1132257083 15:100385037-100385059 AGGCACTCCTTAGGAAAGAGAGG - Intergenic
1136733437 16:32441160-32441182 CGGCGCTCCTTGGGAAACGCAGG - Intergenic
1139520437 16:67479834-67479856 CGGGAGTGGTTGGCAAAGACTGG + Intronic
1141887316 16:86901478-86901500 CAGCACTCCTGGGTCAAGACTGG - Intergenic
1142008615 16:87702274-87702296 CGGCCCTCCTTGCCAAACAGTGG - Intronic
1203019646 16_KI270728v1_random:388442-388464 CGGCGCTCCTTGGGAAACGCAGG + Intergenic
1203037981 16_KI270728v1_random:661600-661622 CGGCGCTCCTTGGGAAACGCAGG + Intergenic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1162009717 19:7805056-7805078 CAGAGCTCCCTGGCAAAGACTGG - Intergenic
1162966784 19:14159959-14159981 CGGCAGTCCTTGGCGGAGAGGGG + Intronic
1163667823 19:18611455-18611477 CGGGACGCGTTGGCAAAGTCAGG - Intronic
1165784114 19:38451148-38451170 AGGCACTCGTTTGCAAAAACAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167469771 19:49669130-49669152 TCCCACTCCTTGGCAAGGACAGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926136874 2:10342726-10342748 CCGGACTCCTGGGCAAAGAGAGG + Intronic
928514165 2:32029655-32029677 AGGCACGAGTTGGCAAAGACTGG + Exonic
929535915 2:42784026-42784048 CGGCACTCCATGGCATGCACCGG - Intronic
934312273 2:91878092-91878114 CGGCGCTCCTTGGGAAACGCAGG + Intergenic
936042003 2:109157060-109157082 GGGCTCTCCTTGGTAAACACAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942385490 2:175438575-175438597 TGGCAATCCTTGGCAAACCCTGG + Intergenic
942395753 2:175547691-175547713 CAGCACCCCTTGTCAAAGACTGG - Intergenic
943911365 2:193572261-193572283 ATGCATTCCTTGGCAAAGATCGG + Intergenic
945909734 2:215635199-215635221 CTGCACCCCTTGGCAAATTCAGG + Intergenic
947514247 2:230787547-230787569 AGGTACTGCTTGGTAAAGACAGG - Intronic
1179016162 21:37595881-37595903 CGGCTCTCCCAGGCAAAGAGAGG + Intergenic
1180539030 22:16423925-16423947 CGGCGCTCCTTGGGAAACGCAGG + Intergenic
1183306793 22:37087053-37087075 CGGCAGTCCATGGCAGAGATAGG + Intronic
1184918332 22:47588522-47588544 GGGGACTCCTTGGCCAAGAGGGG - Intergenic
1185131531 22:49041974-49041996 TGGCACCCCCTGGCAAGGACTGG + Intergenic
949379330 3:3427828-3427850 CGGCACTACTTTGCAAAGCAAGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
957874224 3:86124562-86124584 TGGAACTCCTAGGCAAAGACTGG - Intergenic
961462380 3:127059707-127059729 CGCCACTCATTAGCAAAGGCAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
965664513 3:171078667-171078689 CTCCACTCCTTGGTATAGACAGG + Intronic
968565470 4:1310361-1310383 CGGCACTGCTTAGGAAAGACGGG - Intronic
969463073 4:7339019-7339041 CTGCACCTCTTGGCCAAGACGGG + Intronic
971804022 4:31331630-31331652 TTGTACTCATTGGCAAAGACTGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
975041940 4:69756365-69756387 GGGGACTCCTTGGCACAGTCAGG - Intronic
976620025 4:87117946-87117968 CTGCTCTCCATGGCAGAGACAGG + Intronic
985950733 5:3219809-3219831 CGGCTCTGCCTGGCAAAGCCGGG - Intergenic
986784834 5:11104798-11104820 AGGCTCTCCTTGCAAAAGACAGG + Intronic
992774541 5:80077978-80078000 CGCCACTCCTTGGCAGGGAAGGG - Intronic
994497519 5:100532694-100532716 CAGCAGTCCTTGGCAATAACTGG + Intergenic
996599453 5:125245203-125245225 CTGCACCCCTTGGCAAATTCAGG + Intergenic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015739679 6:136440419-136440441 AGGCACTCCTTGCCAAGGAGAGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019310279 7:357112-357134 CGGCACTGCTTGGCCCAGGCTGG - Intergenic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1022889053 7:34677150-34677172 CGGGACTACTTTGAAAAGACTGG + Intronic
1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1029101260 7:98132094-98132116 AGGCCCTGCTTGCCAAAGACAGG + Intronic
1029703198 7:102261160-102261182 CTGAACTTCTTGGAAAAGACAGG - Intronic
1029726601 7:102410070-102410092 CAGAGCTCCTAGGCAAAGACTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032803965 7:135337911-135337933 GGGCACCCCTTGGCCAAGAGGGG - Intergenic
1035834734 8:2737139-2737161 CAGAACTCTGTGGCAAAGACTGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039487648 8:37924218-37924240 CAGAGCCCCTTGGCAAAGACTGG - Intergenic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1057190699 9:93085753-93085775 CAGTTCTCCTTGGCCAAGACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060770351 9:126327340-126327362 CGGCCCACCTGGGCACAGACTGG + Intronic
1061327778 9:129874675-129874697 GTGCACTCCTTGGCAAGGAAGGG - Exonic
1061386210 9:130290675-130290697 CCTCATTCCTTGGCTAAGACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192187132 X:68955333-68955355 CAGAACCCTTTGGCAAAGACTGG + Intergenic
1193083041 X:77424344-77424366 CCACACAACTTGGCAAAGACTGG + Intergenic
1201180241 Y:11335582-11335604 CGGCGCTCCTTGGGAAACGCAGG + Intergenic