ID: 1101943310

View in Genome Browser
Species Human (GRCh38)
Location 12:109116817-109116839
Sequence GACGGGAGTCGTTTTTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101943310 Original CRISPR GACGGGAGTCGTTTTTCCCC GGG (reversed) Intronic
900136171 1:1117922-1117944 GACGGGGGTCTGTTTTGCCCAGG + Intergenic
900745398 1:4357255-4357277 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
901660126 1:10794054-10794076 GAGGGGGGTAGTTGTTCCCCGGG - Intronic
902968416 1:20029180-20029202 GAAGGGAGATGGTTTTCCCCTGG + Intronic
908057506 1:60305530-60305552 TATGGGAGTCTTTTTCCCCCTGG + Intergenic
910050943 1:82973435-82973457 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
911587218 1:99704867-99704889 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
913457602 1:119049279-119049301 GAAGGGAGATGGTTTTCCCCTGG - Intronic
919539120 1:198827494-198827516 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
920897781 1:210075065-210075087 GAAGGGAGATGGTTTTCCCCTGG + Intronic
921092201 1:211854993-211855015 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
922700070 1:227754125-227754147 GAAGGGAGATGGTTTTCCCCTGG + Intronic
924501504 1:244642813-244642835 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1063067490 10:2624075-2624097 GAGGGCAATCGTGTTTCCCCAGG + Intergenic
1067766791 10:49092977-49092999 GAAGGGAGACGGTTTTCCCCTGG - Intronic
1069209078 10:65733594-65733616 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1071028131 10:81139968-81139990 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1071486849 10:86107861-86107883 GAAGGGAGATGGTTTTCCCCTGG - Intronic
1078885343 11:15494368-15494390 GAGGGCAGTCTTTTGTCCCCAGG + Intergenic
1081010202 11:37801574-37801596 GAGGGGAGTCGTTTGAACCCAGG + Intergenic
1081342680 11:41947494-41947516 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1081352090 11:42066390-42066412 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1086001849 11:81993071-81993093 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1087788724 11:102384747-102384769 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1088103232 11:106177213-106177235 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1088238532 11:107750420-107750442 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1088507308 11:110539305-110539327 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1089122122 11:116144831-116144853 GAAGGGAGCTGGTTTTCCCCTGG - Intergenic
1089444935 11:118544345-118544367 GAGGGGAATCATTTTTCCTCTGG - Intronic
1090024052 11:123152717-123152739 GAGGGGTGTATTTTTTCCCCTGG - Intronic
1094303165 12:28988965-28988987 GGGGGGAGTCATTTTTCCACAGG - Intergenic
1095184610 12:39187036-39187058 GAAGGGAGATGGTTTTCCCCAGG - Intergenic
1095898622 12:47305507-47305529 GAAGGGAGACGGTTCTCCCCCGG + Intergenic
1096171665 12:49476335-49476357 GAAGGGAGACGGTTTTTCCCTGG - Intronic
1101455185 12:104824450-104824472 GAAGGGAGATGGTTTTCCCCTGG - Intronic
1101943310 12:109116817-109116839 GACGGGAGTCGTTTTTCCCCGGG - Intronic
1104791412 12:131484221-131484243 GAAGGGAGATGATTTTCCCCTGG - Intergenic
1106319455 13:28624342-28624364 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1108724375 13:53163900-53163922 GCCTGGAGACGTTTTTCCCATGG + Intergenic
1109138520 13:58683356-58683378 GAAGGGAGATGATTTTCCCCTGG + Intergenic
1109735927 13:66484046-66484068 GAAGGGAGATGGTTTTCCCCTGG - Intronic
1109784544 13:67156542-67156564 GAAGGGAGATGGTTTTCCCCTGG - Intronic
1110835174 13:80074663-80074685 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1111292178 13:86185002-86185024 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1111406241 13:87810901-87810923 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1111708841 13:91785400-91785422 GAAGGCAATTGTTTTTCCCCAGG - Intronic
1119158380 14:72432195-72432217 GACAGGAGTCCTTTGTCCTCTGG + Intronic
1121908259 14:97767035-97767057 GAAGGGAGATGCTTTTCCCCTGG + Intergenic
1122371155 14:101229787-101229809 GAAGGGAGACGGTTTTCCCCTGG + Intergenic
1123824016 15:24063095-24063117 GAAGGGAGATGATTTTCCCCTGG + Intergenic
1126228296 15:46296464-46296486 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1128046064 15:64618619-64618641 GAAGGGAGATGGTTTTCCCCTGG + Intronic
1137853827 16:51773391-51773413 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1139170877 16:64628005-64628027 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1142725527 17:1810899-1810921 GAAGGGAGATGGTTTTCCCCTGG - Intronic
1143290243 17:5822800-5822822 GAAGGGAGATGGTTTTCCCCTGG + Intronic
1148055975 17:44795959-44795981 GAAGGGAGATGCTTTTCCCCTGG + Intergenic
1151975253 17:77480709-77480731 GAGGGGAGTGGCTTTTCCCTGGG - Intronic
1152728897 17:81960477-81960499 GACGGAAGCCCTTTCTCCCCGGG + Intronic
1153710493 18:7794050-7794072 GAAGGGAGATGATTTTCCCCTGG - Intronic
1156551917 18:38027433-38027455 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1157858916 18:51124014-51124036 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1158180760 18:54712912-54712934 GAAGGGAGACGGTTTTCCCCTGG + Intergenic
1158187859 18:54791931-54791953 GAAGGGAGATGGTTTTCCCCTGG - Intronic
1159345773 18:67201218-67201240 GAGGGGAGATGGTTTTCCCCTGG + Intergenic
1160528989 18:79552733-79552755 GATGGGAGTCGTTTTACCCATGG + Intergenic
925424757 2:3739626-3739648 GAAGGGAGACGGTTTTTCCCTGG - Intronic
925806761 2:7658577-7658599 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
927584012 2:24282361-24282383 GAAGGGAGACGGTTTTACCCTGG - Intronic
928730564 2:34227016-34227038 CACTGGAGTCAGTTTTCCCCAGG - Intergenic
931034747 2:58227451-58227473 GAAGGGAGACGGTTTTCCCCTGG + Intronic
931470166 2:62531663-62531685 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
934957061 2:98631663-98631685 GAAGGGAGATGGTTTTCCCCTGG - Intronic
941974397 2:171386987-171387009 GAAGGGAGATGGTTTTCCCCTGG - Intronic
948302667 2:236919769-236919791 GAAGGGAGATGGTTTTCCCCCGG + Intergenic
1171384213 20:24756773-24756795 CAAGGGAGACGGTTTTCCCCTGG + Intergenic
1172226662 20:33309902-33309924 CACAGGAGTCATTTTGCCCCTGG + Intergenic
1172252704 20:33490639-33490661 GGCGGGTGTAGTATTTCCCCAGG - Intronic
1175610052 20:60343216-60343238 GACAGGAGTCCTTCTTCCCTGGG - Intergenic
1177601297 21:23318265-23318287 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1180969817 22:19809346-19809368 GAAGGGAGATGGTTTTCCCCTGG - Intronic
1181040607 22:20190788-20190810 GAAGGGAGATGATTTTCCCCTGG - Intergenic
1181044002 22:20206078-20206100 GAGGGGAGATGGTTTTCCCCTGG + Intergenic
1181877253 22:25949308-25949330 GGCTGGAGTTGTCTTTCCCCTGG - Intronic
1184438626 22:44495697-44495719 GAAGGGAGTCTGTTTTCCCTTGG + Exonic
956194111 3:66635076-66635098 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
956483249 3:69694018-69694040 GAGGGGAGTCTTATTTCCCTGGG + Intergenic
956511684 3:69999923-69999945 GAAGGGAGGTGGTTTTCCCCTGG - Intergenic
958632902 3:96703926-96703948 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
960023951 3:112987827-112987849 GAAGGGAGATGGTTTTCCCCAGG + Intergenic
963997001 3:151721386-151721408 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
966761250 3:183420837-183420859 AATGGGAGTGGTTTTTCCCCAGG - Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
974012279 4:56617843-56617865 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
974752062 4:66154321-66154343 GAAAGGAGACGGTTTTCCCCTGG - Intergenic
974963410 4:68731322-68731344 GACGGGTGGCATTTTGCCCCGGG - Intergenic
976751434 4:88454557-88454579 GAAGGGAGTTGGTTTTCCCCTGG - Intergenic
979862133 4:125707330-125707352 GAAGGGAGATGTTCTTCCCCAGG + Intergenic
983164911 4:164463435-164463457 GACGGAAGTCTTTTTTGGCCAGG - Intergenic
984261247 4:177445326-177445348 GAAGGGAGACGGTTTTCTCCTGG - Intergenic
984271894 4:177557705-177557727 GAAGGGAGATGGTTTTCCCCCGG - Intergenic
986365320 5:7023052-7023074 GAAGGGAGACAGTTTTCCCCTGG + Intergenic
986484016 5:8217277-8217299 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
986800483 5:11255226-11255248 GAAGTGAGTTTTTTTTCCCCAGG - Intronic
990560629 5:56980065-56980087 GAAGGGAGGTGGTTTTCCCCTGG + Intergenic
994301919 5:98157487-98157509 GAGGGGAGATGGTTTTCCCCTGG + Intergenic
994884995 5:105549084-105549106 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
996486596 5:124042257-124042279 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
996565890 5:124879714-124879736 GAAGGGAGATGATTTTCCCCTGG + Intergenic
997155895 5:131556979-131557001 GACGGGAGTCTATGTTGCCCAGG + Intronic
1002476993 5:179472679-179472701 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1002842770 6:920783-920805 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1002843352 6:924535-924557 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1004027309 6:11831716-11831738 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1004417251 6:15436306-15436328 GAAGGGAGATGGTTTTCCCCTGG + Intronic
1006100702 6:31684373-31684395 GAGGGGTGTCCTTTGTCCCCAGG + Intergenic
1011639592 6:89406576-89406598 GAAGGGAGACGGTTTTTCCCTGG - Intronic
1012606809 6:101167919-101167941 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1014247248 6:119081693-119081715 GAAGGGAGATGGTTTTCCCCTGG + Intronic
1015729614 6:136334734-136334756 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1017987872 6:159460453-159460475 GACGGAAGTCACTTTTCCCTAGG - Intergenic
1020825039 7:13016530-13016552 GATGGGAGATGGTTTTCCCCTGG - Intergenic
1022877042 7:34544839-34544861 GAAGGGAGATGTTTTTCCCTTGG - Intergenic
1029033213 7:97490586-97490608 GAAGGGAGATGGTTTTCCCCGGG - Intergenic
1030101793 7:105953190-105953212 GAAGGGAGACAGTTTTCCCCTGG - Intronic
1030480964 7:110103209-110103231 GACCGGATTCTTTTTTCCCCAGG + Intergenic
1031219440 7:118945909-118945931 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1034851859 7:154501342-154501364 GCCTGGAGACATTTTTCCCCAGG - Intronic
1035339851 7:158153188-158153210 GAAGGGAGATGATTTTCCCCTGG - Intronic
1036084538 8:5599406-5599428 GACGGGGGTCTTTTGTCCCACGG + Intergenic
1038248592 8:25881916-25881938 GAAGGGAGATGGTTTTCCCCGGG - Intronic
1042598196 8:70471738-70471760 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1046142707 8:110115883-110115905 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1047202105 8:122775988-122776010 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1047542606 8:125785019-125785041 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1048082975 8:131148885-131148907 GAAGGGAGATGTCTTTCCCCTGG + Intergenic
1048135034 8:131740107-131740129 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1050043618 9:1521091-1521113 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1050479299 9:6073382-6073404 GAAGGGAGACGGTTTTTCCCTGG - Intergenic
1051103582 9:13550968-13550990 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1052370140 9:27655133-27655155 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1059042493 9:110829898-110829920 GAAGGGAGACGGTTTTCTCCTGG - Intergenic
1061084874 9:128392988-128393010 GAGGGGAGTCGGGGTTCCCCAGG - Intergenic
1185837751 X:3360959-3360981 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1186954807 X:14670105-14670127 GACTGGAGGCATTTTGCCCCTGG - Intronic
1193898238 X:87141107-87141129 GAAGGGAGATGGTTTTCCCCTGG - Intergenic
1194535673 X:95103562-95103584 GAAGGGAGATGGTTTTCCCCTGG + Intergenic
1201727788 Y:17172581-17172603 GAAGGGAGATGGTTTTCCCCTGG + Intergenic