ID: 1101946738

View in Genome Browser
Species Human (GRCh38)
Location 12:109143129-109143151
Sequence TTGGAGACTCAGAGAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1149
Summary {0: 1, 1: 11, 2: 57, 3: 205, 4: 875}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101946738_1101946746 11 Left 1101946738 12:109143129-109143151 CCTTCCCCTCTCTGAGTCTCCAA 0: 1
1: 11
2: 57
3: 205
4: 875
Right 1101946746 12:109143163-109143185 TAGAATGAGGAGGCTGAGGCTGG 0: 1
1: 1
2: 20
3: 309
4: 5725
1101946738_1101946744 1 Left 1101946738 12:109143129-109143151 CCTTCCCCTCTCTGAGTCTCCAA 0: 1
1: 11
2: 57
3: 205
4: 875
Right 1101946744 12:109143153-109143175 TTATCATCTTTAGAATGAGGAGG 0: 1
1: 0
2: 4
3: 49
4: 461
1101946738_1101946745 7 Left 1101946738 12:109143129-109143151 CCTTCCCCTCTCTGAGTCTCCAA 0: 1
1: 11
2: 57
3: 205
4: 875
Right 1101946745 12:109143159-109143181 TCTTTAGAATGAGGAGGCTGAGG 0: 1
1: 1
2: 3
3: 71
4: 813
1101946738_1101946747 12 Left 1101946738 12:109143129-109143151 CCTTCCCCTCTCTGAGTCTCCAA 0: 1
1: 11
2: 57
3: 205
4: 875
Right 1101946747 12:109143164-109143186 AGAATGAGGAGGCTGAGGCTGGG 0: 1
1: 0
2: 9
3: 100
4: 1057
1101946738_1101946748 20 Left 1101946738 12:109143129-109143151 CCTTCCCCTCTCTGAGTCTCCAA 0: 1
1: 11
2: 57
3: 205
4: 875
Right 1101946748 12:109143172-109143194 GAGGCTGAGGCTGGGCCTGATGG 0: 1
1: 0
2: 35
3: 176
4: 1231
1101946738_1101946743 -2 Left 1101946738 12:109143129-109143151 CCTTCCCCTCTCTGAGTCTCCAA 0: 1
1: 11
2: 57
3: 205
4: 875
Right 1101946743 12:109143150-109143172 AATTTATCATCTTTAGAATGAGG 0: 1
1: 0
2: 11
3: 112
4: 992

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101946738 Original CRISPR TTGGAGACTCAGAGAGGGGA AGG (reversed) Intronic
900300464 1:1974333-1974355 TGGGTGACTCAGAGCGGAGATGG - Intronic
900476903 1:2880250-2880272 GTGGAGGCTCAGGGAGGGGGCGG + Intergenic
900605012 1:3519961-3519983 TGGGGGACACAGGGAGGGGATGG + Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900998227 1:6134297-6134319 GTGCAGAGTCAGAGAGGAGAGGG - Intronic
901056144 1:6449368-6449390 GAGGAGGCCCAGAGAGGGGAGGG - Intronic
901262848 1:7886152-7886174 GGGGAGACTCAGAGTGGGCAGGG - Intergenic
901636238 1:10671584-10671606 TGGGGGCCACAGAGAGGGGAGGG - Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
901771921 1:11534916-11534938 TCGGAGTCTCAGAGAGGTCAAGG + Intronic
902375500 1:16028356-16028378 TTTGAGGCTCAGTGAGGGGGTGG - Intronic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
902664177 1:17926006-17926028 ACAGAGACTCAGAGAGGGGAAGG + Intergenic
902773533 1:18660116-18660138 TTGGAGCCTCTGTCAGGGGAGGG + Intronic
902889801 1:19434272-19434294 ATCGAGGCTCAGAGAGGTGAAGG - Intronic
903045845 1:20563606-20563628 GTGGGGATGCAGAGAGGGGAGGG + Intergenic
903414906 1:23175900-23175922 ATGGAGCCTCAGAGAGGGTAAGG + Intronic
903450937 1:23453168-23453190 TGAGAGAGTCAGAGAGGAGAAGG - Intronic
903465686 1:23551220-23551242 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
903646276 1:24898045-24898067 AGGGAGACTCAGAGAGGGACAGG + Intergenic
903705943 1:25286016-25286038 GTGGAAGCTCAGAGAGGGCAAGG + Intronic
903721292 1:25407391-25407413 GTGGAAGCTCAGAGAGGGCAAGG - Intronic
903734725 1:25522860-25522882 CTGGAGGCTCAGAGAGGGCAAGG - Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903950063 1:26991515-26991537 GTGGAGACTCAGTGAGGGGAAGG - Intergenic
904080571 1:27869879-27869901 ACTGAGACTCAGAGAGGGTATGG + Intergenic
904398969 1:30243370-30243392 CCTGAGACTCAGAGAGGTGAGGG + Intergenic
904747546 1:32720383-32720405 ATGGGGACTCAGTGAGGAGATGG + Intergenic
904990990 1:34592448-34592470 ATGGATACTCAGAGTGGTGAGGG - Intergenic
905350576 1:37343632-37343654 ATGGAAGCTCAGAGAGAGGAAGG + Intergenic
905684400 1:39898508-39898530 CTGAAGATTCAGAGAAGGGAGGG + Intronic
905976056 1:42174644-42174666 ATTGAGACCCAGAGAGGGAAGGG - Intergenic
906608031 1:47184677-47184699 TGAGGGACTCAGTGAGGGGAAGG - Intronic
906659750 1:47573878-47573900 ATGGAGTCTCAGAGAGGGCAAGG + Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
907239375 1:53072588-53072610 TTGGAGACACAAGGATGGGAGGG - Intronic
907474360 1:54695646-54695668 GTGGAGAGACAGGGAGGGGAGGG - Intronic
907488926 1:54796419-54796441 TAACAGACTCAGGGAGGGGAAGG - Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907552184 1:55313841-55313863 ATAGAGGCCCAGAGAGGGGAAGG + Intergenic
907913746 1:58849852-58849874 TTCGAGACTGGGAGTGGGGAAGG - Intergenic
908085593 1:60629888-60629910 TTGAAGACTAACAGAGGAGAAGG - Intergenic
908572967 1:65428381-65428403 AAGGAGACACAGAGAGGGGAAGG - Intronic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
909990969 1:82222269-82222291 GGGGAGACTCAGAGAGAGAAGGG - Intergenic
910086935 1:83414212-83414234 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
911457797 1:98148905-98148927 TTAGAGACTCAGAAGGGGAAAGG + Intergenic
911795329 1:102068738-102068760 TTAGAGATTCAGAAGGGGGAGGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912515720 1:110215481-110215503 TTGGAGACTAGGGTAGGGGAAGG - Intronic
912540883 1:110414367-110414389 TCTGAGGCTCAGAGAGGGGAAGG + Intergenic
913164740 1:116174711-116174733 TTAGAGAATCTGAGAGGAGATGG + Intergenic
913572424 1:120134038-120134060 TTTGAGATTCAGACAGGGGAAGG - Intergenic
914802353 1:150970961-150970983 TTGGATACCCAGAGGAGGGAGGG + Intronic
914887325 1:151596036-151596058 ACCGAGACTCAGAGAGGTGAAGG - Intergenic
915359804 1:155279000-155279022 TGAGACACTAAGAGAGGGGAGGG - Intronic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915731754 1:158058957-158058979 TTGGAGATGCAGAGAGGGAGTGG + Intronic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
917250996 1:173060551-173060573 GTGGTGTGTCAGAGAGGGGATGG - Intergenic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917478144 1:175386389-175386411 CTGGTGAGTCAGAGAGAGGATGG + Intronic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
918132538 1:181642404-181642426 GTGGAGAATCAGAGAGGGACTGG + Intronic
918344921 1:183598750-183598772 TTGAAGACCCAGATAGAGGATGG + Intergenic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919174901 1:194007819-194007841 AAAGAGATTCAGAGAGGGGAAGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919816491 1:201443986-201444008 CTGAAGCCTGAGAGAGGGGAAGG + Intergenic
920006304 1:202836014-202836036 CTGGAGATGGAGAGAGGGGAAGG - Intergenic
920163399 1:204017336-204017358 TGGGAGAGTCAGTGAGGGGGAGG + Intergenic
920390260 1:205595648-205595670 ATTGAGGCTCAGAGAGGGGAAGG - Intronic
920509030 1:206537042-206537064 CAGGAGACTCAGGGAGGCGAGGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920648990 1:207822936-207822958 ATGGAGACACAGAGAGCGCAAGG + Intergenic
922623959 1:227018292-227018314 TTGGAGACTCAGGGTGGCAATGG + Intronic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923024560 1:230194494-230194516 GTGTACAGTCAGAGAGGGGATGG - Intronic
923220655 1:231889603-231889625 CTGGAGACCCTGAGAGGTGAAGG + Intronic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924443307 1:244104568-244104590 TGGGTGACTCAGAGCGTGGAGGG - Intergenic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924621992 1:245669971-245669993 TTGGAGACTCCGAAGGGGAAAGG + Intronic
1063574585 10:7250243-7250265 CTGGAGACTACTAGAGGGGAGGG - Intronic
1063629872 10:7723362-7723384 CTGGGGACTCAGAGAAGAGAGGG - Intronic
1064594216 10:16926984-16927006 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065178455 10:23101164-23101186 TTGGGGACTCAGAGAAGAAAGGG - Intronic
1065319690 10:24497813-24497835 TTGGAGACTCAGAAGTGGGCAGG + Intronic
1066597788 10:37071062-37071084 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1066994790 10:42553583-42553605 TTAGAGACTCAGAAGGGGGCTGG + Intergenic
1067784394 10:49233229-49233251 TGGGAGACTCAGAATGGGGGAGG + Intergenic
1067792615 10:49299433-49299455 CTGGACACGCAGAGAGCGGAAGG + Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068388685 10:56363680-56363702 GTGGAGTCTCAGAGAGGCAAGGG + Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068940004 10:62671293-62671315 TGGGAGGGTGAGAGAGGGGAGGG + Exonic
1069024362 10:63523296-63523318 TTGGAGAATCAGAAAAGGCAAGG + Intronic
1069710198 10:70483126-70483148 TTGGAGCCTGAGGGAGGGAATGG + Intronic
1069923808 10:71834168-71834190 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070629340 10:78073646-78073668 TTGAAGACCCTGAGAGAGGAAGG - Intergenic
1070751193 10:78965031-78965053 GTCGAGTCTCAGAGAGGGGAAGG - Intergenic
1070774971 10:79104136-79104158 TCTGAGGCCCAGAGAGGGGAGGG - Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071300810 10:84254589-84254611 TTACACTCTCAGAGAGGGGAGGG + Intronic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1071575818 10:86725302-86725324 ATTGAGACTCAAAGAGGTGAAGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072232180 10:93423228-93423250 ATGGACACACAGAGAGGGGTCGG + Intronic
1072444979 10:95491252-95491274 TTGGGAAGTCAGAGTGGGGAAGG - Intronic
1072543194 10:96413926-96413948 AGAGAGGCTCAGAGAGGGGAAGG - Intronic
1072872126 10:99131729-99131751 TTGGAGACTCAGAGTTGGAGAGG + Intronic
1073473621 10:103739114-103739136 TAGGAGATCCAGAGAAGGGAGGG + Intronic
1073502270 10:103951163-103951185 TTTGATACTTAGAGAGGGGAAGG + Intergenic
1073763605 10:106657442-106657464 TTGGAGAGTCAGAAAGGGTGAGG + Intronic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1073847583 10:107576305-107576327 TTATAGACAGAGAGAGGGGAAGG + Intergenic
1074370547 10:112897736-112897758 ATGGGGACTCAGAGAGGTGGAGG + Intergenic
1074457679 10:113609711-113609733 GTGGAGGCTCAGAGAGGTGTAGG + Intronic
1074720904 10:116264297-116264319 CTTGAAGCTCAGAGAGGGGAGGG - Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075518475 10:123128920-123128942 TTGGAAACTCAGAGAGAGCATGG + Intergenic
1075567384 10:123514564-123514586 TTTGAGACTCAGAGAGGCCCAGG + Intergenic
1075690424 10:124390261-124390283 CTGGAGGCTCAGAGAGCGGAAGG - Intergenic
1075953427 10:126501898-126501920 TCAGAGACTCAGAAAGGGGAGGG + Intronic
1076215206 10:128687631-128687653 GCTGAGACTCAGAGAAGGGAAGG - Intergenic
1076276874 10:129207653-129207675 TTGGGGGCTCAGAGCGTGGAGGG - Intergenic
1076347583 10:129790391-129790413 TTAGAGACTCAGAAGCGGGAGGG + Intergenic
1076643518 10:131935336-131935358 TAGGAAACTCAGAGACAGGAAGG - Intronic
1077166753 11:1145152-1145174 CTGGAGACTGGGAGAGGGGACGG + Intergenic
1078064970 11:8072281-8072303 TTGGAGATGCAGAGGGGGAAGGG + Intronic
1078243442 11:9551454-9551476 GTGGAGGCTGAGAGTGGGGATGG + Intergenic
1078297573 11:10089200-10089222 TTGGAGACTTAAAGGTGGGAGGG - Intronic
1078441805 11:11374265-11374287 TCGGAGGCTCAGAGAGGCTAGGG - Intronic
1078673335 11:13385091-13385113 TTTGAGACTCAGCCAGGGGAAGG + Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1080510706 11:32967310-32967332 TTGGAGACTCAGAAGGGGAGAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081433178 11:42998730-42998752 ATGGAGACAAAGTGAGGGGATGG + Intergenic
1081436657 11:43034385-43034407 TTGTGGACCCAGGGAGGGGAAGG - Intergenic
1081525491 11:43924897-43924919 TAGGAAAGTCAGAGAGAGGAGGG + Intergenic
1081769420 11:45639111-45639133 TTAGAGTCTCAGCCAGGGGATGG + Intergenic
1081894162 11:46570318-46570340 GAGGAGACTTAGAGTGGGGATGG - Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082660978 11:55910962-55910984 TTAGAGAGACAGAGAGTGGAAGG + Intergenic
1082697351 11:56385730-56385752 TTAGAGACTCAGAAAAGGGGTGG + Intergenic
1082901510 11:58258474-58258496 TTGGAGACTCAGAGGGGAAGAGG - Intergenic
1083050114 11:59769466-59769488 TTGGAAACTCAGAGAGGTTTGGG + Intronic
1083127634 11:60587560-60587582 TTGGAGACACTGAGAGGGAAAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083169452 11:60914359-60914381 CTGGAGAGTCCGAGTGGGGAGGG + Intronic
1083660594 11:64250292-64250314 CTTGAGGCCCAGAGAGGGGAAGG - Intergenic
1083670070 11:64294842-64294864 GTGGAGGCTCAGAGAGGCGTGGG + Intronic
1083717232 11:64584420-64584442 CTTGAGACTGTGAGAGGGGACGG - Intergenic
1083862755 11:65432846-65432868 CTAGAGACTCAAAGTGGGGAGGG - Intergenic
1084475520 11:69386516-69386538 ATGGAGGCTCAGAGAGAGAATGG - Intergenic
1084635237 11:70387790-70387812 TGGGAGACTGGGAGAGGGGAAGG - Intergenic
1084661387 11:70548543-70548565 TTGGGGACTCTGGAAGGGGAAGG - Intronic
1084780249 11:71403526-71403548 ATGGAGGCTCAGAGAAGAGATGG - Intergenic
1084974845 11:72791169-72791191 TTTGAGGCTCAGAGAGGGGCAGG + Intronic
1085016575 11:73177867-73177889 ATGCAGACTCGGAGAAGGGAAGG + Intergenic
1085034462 11:73291815-73291837 GAGGAGGCTCAGAGAAGGGAAGG + Intronic
1085038504 11:73313486-73313508 TTTGAGACCCAGAGAGGAGGTGG + Intronic
1085070414 11:73539124-73539146 ATGAAGACCCAGATAGGGGAAGG - Intronic
1085519104 11:77127846-77127868 TTTGGGACTCAGAGAGGGAACGG - Intergenic
1085813679 11:79712026-79712048 TTGGAGGGTCAGAGGAGGGAAGG - Intergenic
1088553021 11:111033794-111033816 TTGGAGACGCAAAATGGGGAGGG + Intergenic
1088805903 11:113351800-113351822 ATGGAGCCTCTGAGAAGGGAAGG + Intronic
1088843765 11:113648122-113648144 TCAGAGATTCAGAGAGAGGAAGG + Intergenic
1089018964 11:115191689-115191711 TGGGAGGCTCAGATAGGAGATGG + Intronic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089798108 11:120999626-120999648 TTGGAGGCTCAGGGAGTGTAAGG + Intergenic
1090266168 11:125354223-125354245 GTGGAGTCTCAGAGAGCGGCTGG - Intronic
1090412599 11:126519395-126519417 ATGGAAACTCAGAGAGGCAAAGG - Intronic
1090869853 11:130734491-130734513 TTGAAGAGACAGAGTGGGGAGGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091020693 11:132096848-132096870 GTGGAGAGTCTGAGAGGAGAAGG + Intronic
1091174692 11:133547480-133547502 ATAGGGACTCAGAGAGGGGAGGG - Intergenic
1091701103 12:2663564-2663586 TTGGGGACTCGGAGAAGGGCAGG + Intronic
1091732467 12:2891096-2891118 TTGGCGACTCAGGGAGGGACTGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092184661 12:6470222-6470244 GTGGAGACTCGGAGAGGGCGGGG - Intronic
1092205761 12:6613531-6613553 TTGGGGAGTCTGAGAGAGGACGG + Intergenic
1092614378 12:10203050-10203072 TAGGAGTCTCAGAGAGATGATGG - Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093656748 12:21703511-21703533 TTGGAGACTCAGAGGTGGAAGGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094351784 12:29534257-29534279 GTTGAAAGTCAGAGAGGGGAAGG + Intronic
1094474641 12:30831928-30831950 TGAGACACTCAGACAGGGGAGGG + Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1095566061 12:43624244-43624266 TTGGAGAAGCAGGGAGGAGAAGG + Intergenic
1096427443 12:51516153-51516175 TTGGAGACTTAGAGAAGAGGGGG + Intergenic
1096628903 12:52912833-52912855 GTGGACACTCAGAGAGCTGATGG + Intronic
1096657812 12:53102590-53102612 TTGGACACAAAGGGAGGGGAAGG + Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097630152 12:62050968-62050990 TTCGAGACTGAGCGATGGGAAGG - Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100699402 12:97130346-97130368 ATGGAGACTCAGGGAGGGATGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101399926 12:104378306-104378328 TAGGGGACCCAGAAAGGGGAAGG + Intergenic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102024809 12:109708404-109708426 CAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1102195410 12:111021823-111021845 TTGGGCACACAGAGAGGGAAGGG + Intergenic
1102244032 12:111343619-111343641 TTGGGGACTGAGAGAGGGTATGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102914745 12:116744485-116744507 GCTGAGGCTCAGAGAGGGGAAGG + Intronic
1103066525 12:117902937-117902959 TCAGAGACTCAGAGAGGTTAAGG - Intronic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103147156 12:118604791-118604813 TTGGAGAGGCAGTGAGAGGAGGG + Intergenic
1103446858 12:121000364-121000386 GTGGACACTCAAGGAGGGGAGGG + Intronic
1103862485 12:124025938-124025960 TTGGAGAAGCAGGGAAGGGATGG + Intronic
1103914430 12:124369192-124369214 CTGAAGAGTAAGAGAGGGGAAGG + Intronic
1104152411 12:126096301-126096323 ATGGAGCCTCTGAGAGTGGAGGG - Intergenic
1104583629 12:130029568-130029590 TTGCAGACTCAGAGTGGTGTGGG - Intergenic
1104939355 12:132387635-132387657 ATGCGGGCTCAGAGAGGGGAGGG + Intergenic
1104939369 12:132387687-132387709 ATGCGGGCTCAGAGAGGGGAGGG + Intergenic
1104939411 12:132387847-132387869 ATGCGGGCTCAGAGAGGGGAGGG + Intergenic
1104939418 12:132387872-132387894 ATGCGGGCTCAGAGAGGGGAGGG + Intergenic
1104939476 12:132388136-132388158 ATGCAGGCTCAGAGAGGGGAGGG + Intergenic
1104939499 12:132388242-132388264 ATGGGGGCTCAGAGAGGGGAGGG + Intergenic
1105595842 13:21837213-21837235 TTGGAGAACCAGAGAGGCCAGGG - Intergenic
1106665208 13:31844797-31844819 TTTGAAGCTCAGAGAGGTGAAGG - Intergenic
1106772013 13:32970901-32970923 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
1107106818 13:36652317-36652339 TTGGAGAGGGAGAGAGGGAAAGG + Intergenic
1107552784 13:41492845-41492867 TCTGAGGCCCAGAGAGGGGAAGG - Intergenic
1107784164 13:43937671-43937693 ACTGAGGCTCAGAGAGGGGAGGG + Intergenic
1107809815 13:44189533-44189555 TTGGGGGCACAGAGATGGGAAGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108417424 13:50212404-50212426 TTAGAAAAGCAGAGAGGGGAGGG + Intronic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108976642 13:56452319-56452341 TTGGAGACTCAGAATAGGGGAGG - Intergenic
1109061853 13:57631024-57631046 TGGGCGACTCAGGGAGGGCAGGG - Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109883592 13:68512734-68512756 TTACAGACTCATAGAGGGAAGGG + Intergenic
1109885205 13:68532866-68532888 TTGGAGTCTGAGGGAGGGGAAGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110358138 13:74592936-74592958 TTGGAGAGTAAGGGAGAGGAGGG - Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111146282 13:84185098-84185120 ATGGAGGCTGAGAGAGGTGAGGG - Intergenic
1111319780 13:86612060-86612082 ATGGAGACTACTAGAGGGGAAGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1113050290 13:106203835-106203857 TTGGAGACTCAGAGGGGGAAGGG - Intergenic
1113249411 13:108435161-108435183 TTTGAGAGTCAGGGAGGGGATGG - Intergenic
1113576852 13:111401072-111401094 TTGGAAACAGAGAGAGGCGAAGG - Intergenic
1113668806 13:112160987-112161009 ATGGAGAGTCAGAGAGCTGAAGG - Intergenic
1113672952 13:112187494-112187516 AGGGAGACAGAGAGAGGGGAGGG + Intergenic
1114559324 14:23579008-23579030 ATGCAGCCTGAGAGAGGGGAAGG + Intergenic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116683812 14:48011824-48011846 TTGTAGACTCTGAGTGGGGAAGG + Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1116783638 14:49265086-49265108 TTGGAGGCTGGGAGAGGGGTGGG + Intergenic
1117517965 14:56521377-56521399 TTGGAGAGTTAGAAGGGGGAGGG - Intronic
1117573918 14:57078588-57078610 TTGTATCCTCACAGAGGGGAGGG - Intergenic
1117997262 14:61489542-61489564 TAGGAGACTCAGCAAGGGAAGGG + Intronic
1118044657 14:61954037-61954059 ATGGATACTCAAAGATGGGAGGG + Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118473422 14:66095195-66095217 GTGGAGGCTAAGGGAGGGGAGGG + Intergenic
1119261711 14:73241633-73241655 CTGCAGACTCACAGAGGGCAGGG - Intronic
1119558513 14:75571575-75571597 TTGGAGACTCTGAGCTGGGAGGG + Intergenic
1119806946 14:77488290-77488312 ATGGAGGCTCAGGGAGGGTAGGG + Intronic
1119932859 14:78564948-78564970 TTAGAAATTCAGAGAGGGAACGG - Intronic
1121562292 14:94884576-94884598 TTGGAGGCCCAGAGAGGAGGGGG - Intergenic
1121564380 14:94897763-94897785 TTGCAGAATGAGAGAGTGGAGGG - Intergenic
1121876101 14:97455046-97455068 TCGGAGGCTCAGTGAGGGTAAGG - Intergenic
1121924789 14:97917604-97917626 TCTGAGCCTCAGAGATGGGAGGG - Intergenic
1122516459 14:102312344-102312366 TTGGAGACCCAGAGAGGAAAAGG + Intergenic
1122789942 14:104179908-104179930 CGGGAGTCTCAGAGAGGAGACGG + Intronic
1124216451 15:27811348-27811370 TTGGAGATTCAGAATGGGAAGGG + Intronic
1124938492 15:34195416-34195438 ATGGAGACTCAGAGAGGTAGGGG + Intronic
1125028346 15:35052725-35052747 TTGGGGGCTCTGAGAGCGGATGG + Intergenic
1125492632 15:40159621-40159643 CTTGGGACTGAGAGAGGGGAAGG - Intergenic
1125508528 15:40281091-40281113 TGGGAAACCCAGCGAGGGGAGGG + Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126504557 15:49389470-49389492 TTAGAGACTCAGAGCCGGGAGGG + Intronic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1126753413 15:51900357-51900379 TTGGCGACTCAGGATGGGGATGG + Intronic
1127003718 15:54541457-54541479 TTAGAGACTCAAAGAGGCCAGGG + Intronic
1127077320 15:55339848-55339870 CTGGTGACTCAGGGTGGGGAAGG + Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127547850 15:60006196-60006218 TCGGGGCCTCAGGGAGGGGATGG - Exonic
1127925543 15:63537214-63537236 TTAGAGACTGAGGGAAGGGAGGG - Intronic
1127981371 15:64037731-64037753 ATGGAGGCTCAGAGAAGGGAAGG - Intronic
1128092024 15:64925787-64925809 GTGGAGGCTCAGAGAGGTGGAGG + Intronic
1128223333 15:65983764-65983786 TTAGACACTCAGAGAGGAAAGGG + Intronic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1129229502 15:74188983-74189005 ATCGAGACCCAGAGAGAGGAAGG + Intronic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1129684172 15:77675883-77675905 TTGGGGAGCCAGAGTGGGGATGG - Intronic
1129825278 15:78630868-78630890 TTGGAGGCTGAGGGAGGGGAGGG - Intronic
1129941654 15:79502197-79502219 GTGGAAACTCAGAGAGGGGCAGG + Intergenic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130203267 15:81852720-81852742 TGGCAGCCTCAGAGAGGTGAGGG + Intergenic
1130374418 15:83315522-83315544 TTGGAGACTCAGAAGCGGGGAGG + Intergenic
1131329377 15:91482519-91482541 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1131433253 15:92403181-92403203 ATGGAGACTCAGAGAGGTCTCGG + Intronic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131646231 15:94348340-94348362 ATGGAGAGTGAGAGAGGAGAGGG - Intronic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132542913 16:519657-519679 TGGGAGACTCAGAGATTGGAGGG + Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134128561 16:11632874-11632896 TAGGAGGCTCAGAGTGGGGTGGG - Intronic
1134167450 16:11941773-11941795 TGGGAGACTGAGATGGGGGAGGG - Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1135194772 16:20385571-20385593 TTGGAGACTCAGATGCGGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135312881 16:21419425-21419447 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135347767 16:21703946-21703968 TTAGAGGCTCAGAGAGGGAGAGG + Intronic
1135365804 16:21851705-21851727 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135446010 16:22519457-22519479 TGGGAGACTGAGATGGGGGAGGG + Intronic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136013973 16:27383250-27383272 GTAGAGGCTCAGAGAGAGGAAGG + Intergenic
1136152038 16:28357156-28357178 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136168291 16:28471024-28471046 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136194710 16:28644027-28644049 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136211042 16:28758126-28758148 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136255763 16:29038084-29038106 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1136309547 16:29398152-29398174 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136322994 16:29499933-29499955 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136360409 16:29775818-29775840 TTGGAGAAAAAGAGAGGGGAAGG + Intergenic
1136437678 16:30239901-30239923 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136640079 16:31556903-31556925 TGGGAGACTCTGAGAGGGAAAGG + Intergenic
1136651103 16:31672076-31672098 TTAGAGACTTAGAAGGGGGAGGG - Intergenic
1136778646 16:32884391-32884413 TAGGAGGCCCAGAGAGGAGAAGG - Intergenic
1136891974 16:33977123-33977145 TAGGAGGCCCAGAGAGGAGAAGG + Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138478417 16:57285219-57285241 TGGGAGACCCAGCGCGGGGAAGG + Intergenic
1138528668 16:57623092-57623114 ACTGAGACTCAGAGAGGGAAAGG - Intronic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139023924 16:62789939-62789961 TGAGAGACTCAGAAGGGGGAGGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1139659858 16:68413253-68413275 TTGGCCACTCTGAGAGGCGAAGG + Intronic
1140340367 16:74153119-74153141 TTGGGGACTCAGGTAAGGGAAGG + Intergenic
1140365441 16:74377389-74377411 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141259977 16:82443865-82443887 ACTGAGCCTCAGAGAGGGGACGG - Intergenic
1141519862 16:84571532-84571554 GAGGAGACACAAAGAGGGGAGGG - Intronic
1142126969 16:88415088-88415110 ACCGAGGCTCAGAGAGGGGAAGG - Intergenic
1142227959 16:88886568-88886590 ATGCAGGCTCAGAGAGGGGGAGG + Intronic
1203081062 16_KI270728v1_random:1146485-1146507 TAGGAGGCCCAGAGAGGAGAAGG - Intergenic
1142473414 17:176077-176099 AATGAGGCTCAGAGAGGGGAGGG + Intronic
1143032539 17:3975968-3975990 TTTAAGTCTCAGAGAGGGGCTGG + Intergenic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144637498 17:16919646-16919668 TTGGAGACTCCCCAAGGGGAAGG - Intergenic
1144708907 17:17387761-17387783 CTGGAAACTCAGAGAGGTTAGGG - Intergenic
1145018162 17:19412160-19412182 ATTGAGGCCCAGAGAGGGGAAGG + Intronic
1145240859 17:21240511-21240533 TTGGAGAATGAGGAAGGGGACGG + Exonic
1145294557 17:21578081-21578103 CTCCAGACTCAGAGAGGTGATGG - Intergenic
1145369276 17:22295095-22295117 CTTCAGACTCAGAGAGGTGATGG + Intergenic
1146008479 17:29177080-29177102 GTGGAGGCTTAGAGAGGGGAGGG - Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146207910 17:30920721-30920743 TTGGAGGCTCAGAGAAGTGAAGG + Intronic
1146309245 17:31754510-31754532 GTGGAGGTTCAGAGAGGTGAAGG - Intergenic
1146516826 17:33495953-33495975 GTGAAGACTCAGAGAAGGGAAGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146638990 17:34526112-34526134 TTTGAGACTCATAGAGGCTAAGG - Intergenic
1146741409 17:35287064-35287086 TTGGGGACTCAGGGAGGAAAGGG - Intergenic
1146936021 17:36813166-36813188 TGGGAGGCTCAGAGAGGTCAGGG + Intergenic
1147159068 17:38560202-38560224 ATGGAGTCCCAGAGAAGGGAAGG + Intronic
1147241639 17:39094500-39094522 TTGTAGACTCAGAGTGGGGCCGG - Intronic
1147504997 17:41007159-41007181 TTAGAGACTCAAAAAGTGGAGGG + Intergenic
1147611368 17:41803517-41803539 TTGGGGACCGAGAGATGGGATGG - Intronic
1147653831 17:42077401-42077423 ATTGAGGCTCAGAGAGGTGAAGG + Intergenic
1147817988 17:43224029-43224051 TGGGAGAGTCAGAGAGGGTAGGG + Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149559158 17:57595863-57595885 GTTGAGGCTCAGAGAGGGCAAGG + Intronic
1149986723 17:61353177-61353199 ATGGAGGCCCAGGGAGGGGAGGG - Intronic
1150001703 17:61444390-61444412 TTGGAGACTGAATGAGGGAATGG + Intergenic
1150638216 17:66931409-66931431 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
1151200957 17:72467787-72467809 TTGGAGGCTGACAGTGGGGAGGG - Intergenic
1151404117 17:73875847-73875869 TTGGAAACCCAGAGTGAGGAGGG - Intergenic
1151453175 17:74211734-74211756 TTGGAGACTGCGGCAGGGGAGGG - Intergenic
1151523497 17:74647873-74647895 TTGGGGCATCTGAGAGGGGACGG - Intergenic
1151906913 17:77054753-77054775 GGGGAGACTGAGAGAGGAGAAGG + Intergenic
1152218959 17:79050320-79050342 TTTGAGACACACGGAGGGGAAGG - Intergenic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152332270 17:79680119-79680141 TTCGAGACTCAGAGGCAGGAGGG - Intergenic
1152574368 17:81133618-81133640 ATGGAGACTCTGGGAGGGGGAGG + Intronic
1153189288 18:2519960-2519982 TAGGAGACTGAGAGGTGGGAGGG + Intergenic
1153749492 18:8214096-8214118 TTGGAGACTCGGAGGGGGGCAGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154118680 18:11633782-11633804 TGGGAGACTGAGATGGGGGAGGG - Intergenic
1155158624 18:23178126-23178148 TTGGATACTCATGGAGGGGGTGG - Intronic
1155259711 18:24029660-24029682 TTGGGGACTCAGCGGGGGAAGGG - Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155407358 18:25503570-25503592 GTGGAGGCTTAGAGATGGGATGG - Intergenic
1155517843 18:26640889-26640911 TTGGGGACACAGAGAGGACAAGG + Intronic
1155641321 18:28019129-28019151 TTGGAGACTCAGGGAAAGGGTGG + Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156310576 18:35918543-35918565 GTGGAGACCCAGAGGAGGGAAGG - Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1160331894 18:78001281-78001303 TTAGAGACTCAGAAGGGGAAGGG - Intergenic
1160770663 19:829285-829307 GAGGAGGCTCAGAGAAGGGAAGG + Intronic
1160923225 19:1530191-1530213 GTGGAGGCTCAGGGAGAGGAGGG - Intronic
1161037771 19:2095304-2095326 TAGGAGTCACTGAGAGGGGAGGG - Intronic
1161119989 19:2520451-2520473 ATGGAGGCTCAGAGAGGTTAAGG + Intronic
1161273514 19:3403582-3403604 TTGGAGGCCCAGAGAGGGGCAGG + Intronic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161348352 19:3778897-3778919 TTGGAGTTTCAGAGAGGCCAAGG + Intronic
1161397332 19:4051793-4051815 TGGGAGGCCCAGAGAGAGGAAGG + Intronic
1161616518 19:5273971-5273993 AAGAAGACTCAGAGAGGGCAGGG + Intronic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1161847227 19:6718843-6718865 GTGGAGTCTCAGAGAAGGGGAGG + Intronic
1161847287 19:6719037-6719059 GTGGAGTCTCAGAGAAGGGAGGG + Intronic
1162080295 19:8214013-8214035 GTCCAGACTCAGGGAGGGGAAGG - Intronic
1162292719 19:9791957-9791979 ATGGGGACTCAGTGAGGGGGAGG - Intronic
1162362574 19:10228864-10228886 CTGGAGATTAGGAGAGGGGAAGG + Intronic
1162756585 19:12864564-12864586 ATGGAGACTCAAAGAAAGGATGG - Intronic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1163154799 19:15433807-15433829 TTGGAGGTTCAGAGAGGACAGGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163381941 19:16975008-16975030 TTGGAGATTCAGAAATGGGTTGG - Intronic
1163591914 19:18198662-18198684 AAGGACACTAAGAGAGGGGAGGG - Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164818289 19:31223885-31223907 TGGGCCACTCAGTGAGGGGAAGG + Intergenic
1164839954 19:31385697-31385719 TTTGAGGGCCAGAGAGGGGAAGG + Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164994373 19:32708884-32708906 TGGGAGATGCAGAGAGGGTAAGG - Intronic
1165314780 19:35048116-35048138 GCTGAGGCTCAGAGAGGGGAGGG + Intronic
1165830648 19:38728733-38728755 TGGGAGACCACGAGAGGGGAGGG + Intronic
1165905070 19:39188808-39188830 CTGGAGTCTGAGAGAGGGGTCGG - Intergenic
1166091193 19:40510165-40510187 ACTGAGCCTCAGAGAGGGGAAGG - Intronic
1166147076 19:40845234-40845256 CTGGGGACACAGAGAGGGGCTGG + Intronic
1166301826 19:41915414-41915436 ATGGAGACCCAGAGATGGGAGGG - Intronic
1166519401 19:43470261-43470283 TCTGAGACCCAGAGAGAGGAAGG + Intergenic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1166647052 19:44539976-44539998 TTGGACACCCACAGAGGAGAAGG + Intergenic
1166803320 19:45470928-45470950 TAGGAGACCCCGAGAGGAGACGG + Exonic
1166873274 19:45883397-45883419 ACTGAGGCTCAGAGAGGGGATGG - Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1166888747 19:45976765-45976787 TGAGAGACTCAGAAAGGGTAAGG - Intergenic
1167182201 19:47913088-47913110 TCGGACCCTCAGAGAGGCGAGGG + Intergenic
1167184166 19:47928855-47928877 TCGGACCCTCAGAGAGGCGAGGG + Intergenic
1167185490 19:47939578-47939600 TCGGACCCTCAGAGAGGCGAGGG + Intergenic
1167186808 19:47950333-47950355 TCGGACCCTCAGAGAGGCGAGGG + Intergenic
1167187459 19:47955719-47955741 TCGGACCCTCAGAGAGGCGAGGG + Intergenic
1167359165 19:49020700-49020722 ATGGAGACTCAAAGATAGGAGGG + Intergenic
1167413914 19:49360761-49360783 ACAGAGACCCAGAGAGGGGATGG + Intronic
1167422709 19:49413515-49413537 TGGGAGCCTGAAAGAGGGGAGGG - Intronic
1167588875 19:50391675-50391697 AGGGAGACTGAGAGGGGGGAGGG + Intronic
1167646722 19:50710049-50710071 ATGGAGCCTCAAAGAGGGGGAGG + Intronic
1167655895 19:50763969-50763991 TTGGGGACTAAGAGAGTTGAAGG + Intergenic
1167671702 19:50857293-50857315 TGGGAGACACAGAGAAGGGCTGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167706176 19:51082516-51082538 CTGGAGACTCTGAGAAGAGATGG - Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167736714 19:51299076-51299098 GAGGAGACTCAGAGAGGATAAGG + Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168304246 19:55426375-55426397 TTGGAGTCTCAAACTGGGGATGG + Intergenic
1168325236 19:55535541-55535563 GCTGAGACTCAGAGAGGGCAAGG + Intronic
1168454579 19:56496453-56496475 TTGGAGAAACTGAAAGGGGAAGG + Intergenic
1168485696 19:56760169-56760191 TTGGATGCTCAGAGACAGGATGG + Intergenic
925026047 2:608125-608147 TTGAGGAGCCAGAGAGGGGAAGG - Intergenic
925144334 2:1570779-1570801 CTGGAGACTCAGAGGCGGGGAGG - Intergenic
925438808 2:3866394-3866416 TTGGGGCCTCAGCAAGGGGAAGG + Intergenic
925449179 2:3953612-3953634 TTGGAGTCACAGTGATGGGAGGG + Intergenic
925586141 2:5466132-5466154 TGGGAGAATCAGGGAAGGGAAGG - Intergenic
925701808 2:6646423-6646445 ATGGAGTCCCAGAGAGGGGATGG - Intergenic
925831789 2:7903383-7903405 TGGGAGACTCTGTGAGGAGATGG - Intergenic
926685933 2:15697532-15697554 TTGGAGACTCAGACTTGGGTGGG - Intronic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926909501 2:17837902-17837924 TTGAAGATTCAGAGATGTGATGG + Intergenic
927014348 2:18942013-18942035 ATGAAGACTGAGAGAGGTGAGGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
928292127 2:30048743-30048765 TGAGAGGCTCAGAGAGGGTAAGG - Intergenic
928324077 2:30306189-30306211 ATGGAAACTTACAGAGGGGAAGG - Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928761110 2:34584081-34584103 TTGGAGACTGAGAAGTGGGAAGG + Intergenic
929713357 2:44287132-44287154 TTGGAGACTCCTTGAGGGTAAGG - Intronic
929913033 2:46108496-46108518 GTGGAGACTCAGAGAGGTCAAGG + Intronic
930379761 2:50613224-50613246 TTAGTGACTCAGAGAGAGGCTGG - Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930590458 2:53320813-53320835 ATGGAGACTTACAGAGGTGATGG - Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
932282951 2:70510400-70510422 TTGGAGAGCCAGGGTGGGGAGGG - Intronic
932803101 2:74760137-74760159 TTGGTGACTCAGAAAAGAGAGGG - Intergenic
932875062 2:75442793-75442815 TTGGAGATTCAGAAGTGGGAAGG + Intergenic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933173170 2:79146920-79146942 TTGGAGACTCAGGGTGGGGAGGG - Intergenic
933232941 2:79830066-79830088 CTGGAGACTGAGAGAGACGAGGG + Intronic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933604222 2:84364490-84364512 TTGGGGACTCGGAGAAGGGTGGG + Intergenic
933760449 2:85668545-85668567 TGGGAGGCCCAGGGAGGGGATGG - Intronic
933901762 2:86855224-86855246 GAGGAGGCTCAGAGAGGTGAGGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934102933 2:88670146-88670168 ATGGATACTCAGAGAGGTTAAGG + Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934894039 2:98097253-98097275 TTGGAGACTCAGAAGTGGGGAGG - Intronic
935778786 2:106494039-106494061 GAGGAGGCTCAGAGAGGTGAGGG + Intergenic
935801793 2:106704823-106704845 TTGGGGACTCAGGGAAGGGTAGG + Intergenic
935831889 2:107008806-107008828 TGGGAGAATAAGAGAGGTGATGG + Intergenic
936140536 2:109936235-109936257 GTGAAGACACAGAGAGGAGATGG + Intergenic
936177227 2:110234180-110234202 GTGAAGACACAGAGAGGAGATGG + Intergenic
936204158 2:110435251-110435273 GTGAAGACACAGAGAGGAGATGG - Exonic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936533599 2:113293707-113293729 GTGGGGACTCAGAGAGGATAAGG - Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937342195 2:121098457-121098479 ATGGAGGTTCAGAGAGGAGAAGG - Intergenic
937580006 2:123473831-123473853 CAGGACACTCAAAGAGGGGAGGG - Intergenic
937871266 2:126787932-126787954 CAGGACACTCAGAGAGGTGAAGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939106173 2:137951166-137951188 TTGGAGACTCAGAAGTGGAAGGG - Intergenic
939834107 2:147106981-147107003 ATGGAGACTCAGAGAGCAGTTGG + Intergenic
939946431 2:148416774-148416796 TTGGATACTCAGATGAGGGAGGG - Intronic
941530769 2:166667834-166667856 TTAGGGACTCAGAGGGGGAAGGG + Intergenic
941702611 2:168620259-168620281 TTGGGGACTCAGGGAAAGGATGG + Intronic
941883218 2:170502542-170502564 CTGAAGAGCCAGAGAGGGGACGG - Intronic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943436200 2:187868141-187868163 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436207 2:187868191-187868213 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436234 2:187868385-187868407 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436252 2:187868532-187868554 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436326 2:187869066-187869088 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
944636115 2:201677714-201677736 TCAGATCCTCAGAGAGGGGAGGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945373916 2:209056534-209056556 TTGGAGATTCAGAAAAGGGGAGG + Intergenic
946059279 2:216927699-216927721 TTAGAGACTGAGAGGGGGCAGGG + Intergenic
946150517 2:217764156-217764178 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
946309748 2:218876861-218876883 TGGGAAACTCAGAGAGTGGTGGG + Intergenic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
946633857 2:221702459-221702481 TTGGGGACTTTGAGAGTGGAAGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947131508 2:226931477-226931499 TTTGAGACTCAGAAGGGGAAAGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947569032 2:231216553-231216575 AAGGAGCCTCAGAGAGAGGATGG + Intronic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948459723 2:238123394-238123416 ATTGAGGCTCAGAGAGGGCAAGG - Intronic
948653183 2:239461926-239461948 TTGGAGACACAGAGAGAGAATGG + Intergenic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948746781 2:240102205-240102227 TTAGAGACTAAGAAAGGGGAGGG + Intergenic
1168799087 20:633240-633262 GCTGAGACTCAGAGTGGGGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169340214 20:4790605-4790627 CTGGAGTCTGAGAGAGGAGAGGG + Exonic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169801285 20:9514929-9514951 TTGGCGACTGGGAGAGAGGACGG + Intronic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170774780 20:19365759-19365781 ATGGAGCCTCAGAGATGGGCTGG - Intronic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1170961891 20:21032835-21032857 TTGGAGACTCAGAGGTGGGGAGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172448239 20:35004105-35004127 CAGGAGGCTCAGAGAAGGGAAGG + Intronic
1172594293 20:36139657-36139679 ACTGAGACCCAGAGAGGGGAAGG - Intronic
1172818803 20:37713341-37713363 TTAAGCACTCAGAGAGGGGAGGG - Intronic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173159433 20:40641382-40641404 GTAAAGGCTCAGAGAGGGGAAGG - Intergenic
1173324407 20:42019442-42019464 ACTGAGTCTCAGAGAGGGGAAGG - Intergenic
1173382063 20:42554451-42554473 TTGCAGACTCTGTGAGGGCAGGG + Intronic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173575390 20:44110110-44110132 TTGGAGACTCAGAGCCAGGTAGG - Intergenic
1173648238 20:44646926-44646948 ACTGAGACTCAGAGAGGGGAGGG - Intronic
1173834261 20:46114795-46114817 TTGGAAACTCAGAGATGAAATGG - Intergenic
1173903423 20:46607643-46607665 TCTGAGACTCAGGAAGGGGAAGG - Intronic
1174107148 20:48170857-48170879 ATTGATACTCAGAGAGGGTAAGG - Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1174423370 20:50415430-50415452 AAGGAGACTCAGAGAGGGCTGGG + Intergenic
1175152075 20:56942885-56942907 TTGGCAACTCTGAGGGGGGAAGG - Intergenic
1175305707 20:57974186-57974208 TGGGAGGCTGAGAGAGTGGATGG - Intergenic
1175922874 20:62458315-62458337 GTGGAGACTCTGAGATGTGATGG + Intergenic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1178383989 21:32134717-32134739 ATGCCGGCTCAGAGAGGGGATGG - Intergenic
1178741550 21:35206621-35206643 TCAGAGACACAGAGAGAGGAGGG - Intronic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1178901380 21:36601611-36601633 TTAGAGACCCAGGAAGGGGAGGG + Intergenic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179056357 21:37938754-37938776 TTGGGAACTCAGGAAGGGGAAGG + Intergenic
1179057999 21:37953847-37953869 ATGGAGACACAGAGAGCTGAAGG + Intronic
1179313248 21:40215640-40215662 TTGGAGACTCAGAAGTGGGGAGG + Intronic
1180029267 21:45192640-45192662 TTGAAGACAGAGAGAGGGCAAGG + Intronic
1180044118 21:45295030-45295052 TTAGAGATTCTAAGAGGGGAAGG + Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180594031 22:16962131-16962153 TGGGAGAGGCAGAGAGGGAAGGG - Exonic
1182049668 22:27303085-27303107 ATTGAGGCTCAGAGAGGTGAAGG + Intergenic
1182087864 22:27573818-27573840 CTTGGGACTCAGAGAGGGGCTGG + Intergenic
1182287706 22:29258118-29258140 ATGGACACTCAGGGAGGAGAGGG - Intronic
1182542976 22:31055259-31055281 AAGGAGGCCCAGAGAGGGGAGGG - Intergenic
1183013017 22:34962884-34962906 GTGGAGGCCCAGAGACGGGAGGG - Intergenic
1183064314 22:35352928-35352950 GTGGAGGCCCAGGGAGGGGAGGG + Intergenic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183809069 22:40238637-40238659 ATGGAGACTCACTGAGGTGAGGG - Intronic
1184090600 22:42291096-42291118 ATGGAGTCCCAGAGACGGGAAGG - Intronic
1185236825 22:49718747-49718769 CTGGAGAATGAGAGAGGAGAGGG - Intergenic
1185419733 22:50728710-50728732 GTGGACACCCAGAGAGGGGCAGG - Intergenic
949159278 3:860529-860551 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159306 3:860776-860798 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
950128047 3:10522783-10522805 CTGGAGGCTCAGAGAGGTAATGG + Intronic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950206941 3:11088175-11088197 ACAGAAACTCAGAGAGGGGAAGG + Intergenic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
950451925 3:13070267-13070289 ACTGAGGCTCAGAGAGGGGAAGG - Intronic
950456768 3:13097369-13097391 CTGGAGACTCAGTGACTGGAGGG - Intergenic
950669457 3:14517364-14517386 TTTGAGACCCAGAGAGGAAAGGG - Intronic
950912399 3:16607803-16607825 TTATAAACTGAGAGAGGGGAGGG - Intronic
950945765 3:16944594-16944616 GTGAAGACACAGAGAGGAGATGG + Intronic
951262354 3:20525207-20525229 GTGGAGACTCAGAGAAGAGATGG - Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952618086 3:35299896-35299918 TTAGAAACTCAGAAACGGGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
953026652 3:39148984-39149006 TTGGAGGCACAGAGAGGTTAAGG - Intronic
953081239 3:39620530-39620552 TTAGAGACCCAGAAATGGGAGGG + Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
954144432 3:48627419-48627441 TTAGAGACTGAGACAGGGCAGGG - Intronic
954479277 3:50782793-50782815 TTGGGGACTCGGTGGGGGGAAGG - Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
954623550 3:52009682-52009704 TGGGAGATTGAGAGGGGGGAAGG - Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956314503 3:67919515-67919537 TTGGAGACTCTGAAAGTGGGAGG - Intergenic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
958986471 3:100784868-100784890 TTAGAGACCCAGAAGGGGGAGGG + Intronic
960004982 3:112772570-112772592 TTGGAGAGGCAGAGAGGAGGAGG - Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960752283 3:120968711-120968733 TTGGATACTCAGAACGGGGGAGG - Intronic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961643871 3:128382066-128382088 CAGGAGACTCAGAGAGGAGAGGG - Intronic
961670480 3:128524661-128524683 TCAGAGGCTCAGAGAAGGGAAGG - Intergenic
961793410 3:129392700-129392722 CTGGTGACTCAGAGAGGGCATGG + Intergenic
961807407 3:129499318-129499340 CTGGTGACTCAGAGAGGGCATGG + Intronic
961820786 3:129574719-129574741 CTGGAGTCTCTGTGAGGGGAAGG - Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962011317 3:131393777-131393799 TTGGATTCTCAGATAGGGGATGG - Intergenic
962516192 3:136154425-136154447 TTGGAGAGTAAGAGTGGAGATGG - Intronic
962637443 3:137345592-137345614 CTGGAGGCTGAGAGAGGAGAAGG + Intergenic
963106473 3:141651847-141651869 CTGGAGACTCAGAGAAGAGTGGG + Intergenic
963168667 3:142229952-142229974 TTGGAGACCCAGAAATGGGAGGG + Intergenic
964285581 3:155114166-155114188 TATGAGACTCAAAGTGGGGAGGG + Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
964991002 3:162812578-162812600 TTGTGGACTAATAGAGGGGAGGG - Intergenic
965336177 3:167432404-167432426 GTAGAGACACAGAGAAGGGATGG - Intergenic
966313872 3:178624721-178624743 TTGGGGGCTCAGGGAGGGGTGGG + Intronic
967081026 3:186049597-186049619 CTGGAGACGCAGAGGGGGAAGGG + Intronic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967728501 3:192884336-192884358 TTGGAGACTCAGGTAGGTGGAGG + Intronic
967882878 3:194314209-194314231 ATTGAGACCCAGAGAGGGTAAGG - Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968067129 3:195764886-195764908 GTGGAGGCCCAGAGAGGGGAAGG + Intronic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
969173291 4:5380849-5380871 ATTGAGACTCAGAGGAGGGAAGG + Intronic
969286957 4:6208551-6208573 TCTGAGGCTCAGAGAGGTGAAGG - Intergenic
969435708 4:7188135-7188157 TTTGAGAAACAGAGAGGTGAGGG + Intergenic
969581283 4:8067068-8067090 GTCGAGGCTCAGAGAGGCGAGGG + Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
969915947 4:10491932-10491954 TTGAAGGCTCAGAGAGGGAGAGG - Intronic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970200161 4:13596297-13596319 TTCTAGACTCAGAGACAGGAGGG - Intronic
970659069 4:18264251-18264273 CTGGAGACACAGAGAGTGAAGGG + Intergenic
970904539 4:21200621-21200643 TGGGAGACTCAAAGAAGAGAGGG + Intronic
971176868 4:24290443-24290465 ATGGAGGCTCAGAGAGGCTAAGG - Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972213191 4:36863235-36863257 TTGGAGACTCAGACGGGGAGAGG + Intergenic
972266545 4:37465472-37465494 AGGGAGCCCCAGAGAGGGGAGGG + Intronic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
973192408 4:47400727-47400749 TTGGAGACTCAGAAGTGGGGAGG - Intronic
973283506 4:48388655-48388677 TAGGAGACTCAGGGAGGAGCTGG - Intronic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974074275 4:57154726-57154748 ATGGAAACTCGGAGAGGTGAGGG + Intergenic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975078445 4:70243555-70243577 TTAAAGCCTCAGATAGGGGATGG - Intronic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975380823 4:73698870-73698892 TTGGAGACTCAGAGCAGGGAGGG - Intergenic
975437445 4:74369307-74369329 TTAGAGACTCAGAAGGGGAAGGG - Intronic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976884734 4:89969303-89969325 GTAGAGACACGGAGAGGGGATGG + Intergenic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977954816 4:103014892-103014914 ATTGAGACTCAGAGAGGTTAAGG - Intronic
978530205 4:109704519-109704541 ATGGAGGCTGAGAGAGGTGAGGG + Intergenic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979955247 4:126945234-126945256 TTGGAGAATGAGTGAGGAGATGG - Intergenic
980378769 4:131982129-131982151 TTGGAGACTCAGATGTGGGGAGG - Intergenic
980747638 4:137040303-137040325 TTGGAAACTCAGAATGGGGGAGG - Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981381410 4:144076245-144076267 TTGGAGACTCAGAAGCGGGTGGG - Intergenic
981523295 4:145687246-145687268 AGGAAGACTCAAAGAGGGGAGGG - Intronic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982267369 4:153550853-153550875 TTGGAGACTCAAGATGGGGAAGG + Intronic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983803623 4:171966366-171966388 TTGGTGAATGAGAGTGGGGATGG + Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984571725 4:181403485-181403507 CTGGAGACAGAGAGAGGGCAGGG + Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
985233608 4:187848957-187848979 CTGGAGGCTCAGAGAGGGGCAGG - Intergenic
985543744 5:499031-499053 CTGGGGACCAAGAGAGGGGAAGG + Intronic
985671573 5:1209494-1209516 TTGGAGACTCAGGGAGAGGCTGG - Intronic
986342649 5:6804189-6804211 GTGGATCCTCAGAGAGGGCATGG - Intergenic
986408586 5:7452252-7452274 TTGGAAACTCAGAAATGGGGAGG - Intronic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
988062278 5:26186500-26186522 TTGGAGGCTGAGATAGAGGAAGG - Intergenic
988065376 5:26224871-26224893 TTGGAGACCCAGGGAGGAGCTGG - Intergenic
988065534 5:26226096-26226118 TTGGAGACCCAGAGAGGACCTGG - Intergenic
988065540 5:26226146-26226168 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065571 5:26226392-26226414 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065635 5:26226881-26226903 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065721 5:26227617-26227639 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988264846 5:28935356-28935378 TTTGACACACAGAGAGGAGAAGG - Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989407748 5:41080303-41080325 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
989607539 5:43258928-43258950 TTGGAGACTTAGAAGGGGTAGGG - Intronic
989723583 5:44559568-44559590 TTGGGGACTCAGGGAGAGGGTGG + Intergenic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991634391 5:68689826-68689848 TTGGGGAGTCAGAGTTGGGAGGG - Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992407367 5:76472362-76472384 TTGGGGCCTCAGAGAGGTGTTGG + Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
993637551 5:90363480-90363502 TTGAAGACTCAGGGAGGAGTGGG + Intergenic
993768448 5:91893182-91893204 TTGAAGATTGAGAGAGGGGAAGG + Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994415607 5:99466633-99466655 TTGAAAACTCAGAAAGGAGAAGG + Intergenic
994958828 5:106571460-106571482 TGGGAGACTCTGAAAGGGAAGGG + Intergenic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
995826103 5:116301425-116301447 CTGGAAAATCAGAGACGGGAAGG - Intronic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996577078 5:124987582-124987604 TTGCAGACATAGAGAAGGGATGG + Intergenic
996620413 5:125495036-125495058 TTAGAGACTCAGAAGGGGAAGGG + Intergenic
996836903 5:127803707-127803729 CTGGAAACTGAGAGATGGGATGG - Intergenic
997886729 5:137637115-137637137 GTTGAGACTCAGAGAGGTGGTGG - Intronic
999125747 5:149244661-149244683 TTGGAGCACCAGAGAGGGGAAGG - Intronic
999304544 5:150511232-150511254 TAGCAGATTCACAGAGGGGAAGG + Intronic
999323830 5:150630857-150630879 TTTGAGGCCCAGAGAGGGAAAGG - Intronic
999378065 5:151100853-151100875 ATAGAGACTCAGGGAGGGAAAGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999718552 5:154381357-154381379 TTGGAGCACCAGAGAGGGGCTGG - Intronic
999916853 5:156272176-156272198 TTGGGGACTCACAGAGTGGGGGG - Intronic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000202635 5:159026837-159026859 TTAGAGACACAGGGAGGGCAAGG - Intronic
1000311090 5:160045555-160045577 TGAGAGATTGAGAGAGGGGAGGG - Intronic
1000337242 5:160250945-160250967 ATGGAGGCTCAGAGAGAGGTTGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1000821004 5:165983167-165983189 TTGGAGACTCTGAATGGGGGAGG + Intergenic
1001001934 5:168015693-168015715 TTGCTGACTCAGAGAAGGAATGG - Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001397446 5:171427523-171427545 GTGGAGACTCAGAGAGGTTAAGG - Intronic
1001412751 5:171522433-171522455 ATGGAGGCACAGAGAGGGGAAGG - Intergenic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1001551065 5:172602700-172602722 ATGGAGGCTCAGAGAGTGAAGGG - Intergenic
1001557254 5:172645219-172645241 GTGGAGGCTCAGAGAGGTCAAGG + Intronic
1001734484 5:173987956-173987978 ATGGAGGCTCAGAGAAGGAAAGG + Intronic
1001760882 5:174207150-174207172 TTGGAAACTCAAAAGGGGGAGGG + Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1001958434 5:175864376-175864398 TTGGAGGCTCAAAGCAGGGAAGG - Intronic
1002419087 5:179136199-179136221 TAGGAGACACAGAGACAGGAAGG - Intronic
1002520959 5:179793111-179793133 CAGGAAACTCAGAGTGGGGAGGG - Intronic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002996931 6:2295278-2295300 TTGGAGACTGACAAGGGGGAGGG + Intergenic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003821223 6:9899053-9899075 TTTGAGACTCAGACATGTGAAGG - Intronic
1003960184 6:11201561-11201583 TGGGAGACAGAGAGATGGGATGG + Intronic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1004985277 6:21074974-21074996 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1005917601 6:30367036-30367058 ATGGAGACACAGAGAAGTGAAGG + Intergenic
1006079897 6:31559131-31559153 TTGGGGAGCCAGGGAGGGGAGGG - Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006813095 6:36833227-36833249 ATTGAGGCTCAGAGAGGTGAAGG - Intronic
1006828348 6:36953576-36953598 TTGGAGACTCAGGCAGGGACAGG + Intronic
1007040357 6:38715747-38715769 TCGGAGACTCAGAAGGGGAAGGG + Intronic
1007087625 6:39160528-39160550 TTGGCAATTCAGAGAAGGGAAGG - Intergenic
1007223739 6:40298634-40298656 CTGGGGACTCAGGGAGGGCAAGG + Intergenic
1007403843 6:41621162-41621184 TTGGAGACCCAGATAGGGTGAGG - Intergenic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1007703205 6:43776212-43776234 TTGGAGGCCTAGAGAGGGGAGGG + Intronic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1010255662 6:73754409-73754431 TTAGAGACTGAGTGAGGGGAAGG + Intronic
1010452037 6:76014331-76014353 TTTGAAACTCAGAGGGAGGAAGG + Intronic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1011364234 6:86563189-86563211 TTGGAGATTCAGAGGGGGTCAGG - Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1011829146 6:91349606-91349628 ATGAAGACTGAGAGAGGTGAAGG + Intergenic
1012729698 6:102866682-102866704 TTGGAGACTCAAAAGGGGAAAGG + Intergenic
1012787674 6:103652809-103652831 TTAGAGACTCTGAGAAGAGATGG - Intergenic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013806796 6:114005381-114005403 ATGGAGTCTCAGAGTTGGGAGGG + Intronic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1014812488 6:125902357-125902379 TTGGAAGCTCAGAGAGGTTAAGG + Intronic
1015102670 6:129499923-129499945 TTGGAGAGACAGAGGGGGGCAGG + Intronic
1015515145 6:134075887-134075909 TTTGAGAGTCAGAGCAGGGAAGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015775806 6:136812916-136812938 TGGGACACTCAGAGAGGGGGTGG - Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016627535 6:146189970-146189992 TTGGCAACTCAAAGATGGGAGGG + Intronic
1016741318 6:147532297-147532319 TTGGGGACTCAGGGAGGTGGGGG - Intronic
1017009595 6:150054298-150054320 CTGGAGACTCAGGGAGGAGCTGG - Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1017967016 6:159275792-159275814 GTGGGGAATCAGAGAAGGGATGG - Intergenic
1019098861 6:169610880-169610902 TTGGAGACTCACAAGGGGGCAGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1020297710 7:6771015-6771037 TTGGGGAGAGAGAGAGGGGAGGG + Intronic
1020560981 7:9728341-9728363 TTGGAGATTCAGAAATGGGTTGG + Intergenic
1021437308 7:20634025-20634047 TTGGAGACTCAGAGGCTGAAAGG - Intronic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022418042 7:30195160-30195182 ACTGAGACTCAGAGAGGGGCAGG - Intergenic
1022816065 7:33915587-33915609 ATGAAGGCTCAGAGAGGGTAAGG - Intronic
1023160168 7:37289237-37289259 TTGGATTGTGAGAGAGGGGAAGG - Intronic
1023507363 7:40914141-40914163 TTAGGGACTGAAAGAGGGGAAGG - Intergenic
1023795658 7:43789799-43789821 ATGGAGACTCAGGGTGGGAAAGG - Intronic
1023927110 7:44677504-44677526 TTGGGGACACAGAGCAGGGAGGG + Intronic
1023993128 7:45142041-45142063 TCTGAGACCCAGAGAGGGGACGG - Intergenic
1024062283 7:45708178-45708200 TAGGAGACTAAGAGAGAGGCAGG - Intronic
1024094568 7:45973720-45973742 TGGGAGACTCAGAAAAGTGAGGG + Intergenic
1024553344 7:50581980-50582002 GTTGACACTGAGAGAGGGGAAGG - Intergenic
1024575017 7:50756301-50756323 TTGGAGACGCAGAGATGTGTGGG - Intronic
1024666068 7:51548454-51548476 TTTGAGACTCACTGAAGGGAGGG - Intergenic
1025932926 7:66010842-66010864 CTGGAGACAGAGAGAGGAGAAGG + Intergenic
1025950457 7:66141411-66141433 CTGGAGACAGAGAGAGGAGAAGG - Intronic
1026067340 7:67086584-67086606 TTGGAGACTCAGGGAAGAGTGGG + Intronic
1026506927 7:70992804-70992826 TTGGAGACTCACAAATGGGCAGG - Intergenic
1026709583 7:72725743-72725765 TTGGAGACTCAGGGAAGAGTGGG - Intronic
1026743200 7:72991454-72991476 GGGGAGTGTCAGAGAGGGGATGG + Intergenic
1026803065 7:73411907-73411929 GGGGAGTGTCAGAGAGGGGATGG + Intergenic
1027029314 7:74876151-74876173 GGGGAGTGTCAGAGAGGGGATGG + Intergenic
1027100535 7:75373624-75373646 GGGGAGTGTCAGAGAGGGGATGG - Intergenic
1027303817 7:76870697-76870719 TTAAAGACTCAGAAAGGGGTGGG + Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027525859 7:79267770-79267792 TTTGAGACTCAAAGAGGGGCTGG + Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027918956 7:84365478-84365500 TTGGAGACAAAGAGAGATGAGGG - Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029928469 7:104344418-104344440 TTGGAGATTCAGAAGGGGAAGGG - Intronic
1030719115 7:112848527-112848549 TAGAACACTCAGAGAAGGGAAGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031020006 7:116617309-116617331 TTTGAGACATAAAGAGGGGAGGG + Intergenic
1031656608 7:124363917-124363939 TTAGAGACTCATAAGGGGGAGGG - Intergenic
1032516073 7:132507365-132507387 AATGAGACTCAGAGATGGGATGG + Intronic
1033854192 7:145536916-145536938 CTGGAGACTGGGAGAGGAGATGG + Intergenic
1034424916 7:151009351-151009373 ATGGGGAGTCAGAGAGGGGTGGG - Intronic
1034560328 7:151876086-151876108 CTGGAGACGGAGAGAGGGGAGGG - Intronic
1034627055 7:152501780-152501802 ATGGGGACCCAGAGAAGGGAGGG - Intergenic
1034743338 7:153498704-153498726 GTGGAGGCTGAGAGAGGTGAGGG + Intergenic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1034820946 7:154215794-154215816 CTGGCGACCCAGAGAGGGGAAGG - Intronic
1035081083 7:156216546-156216568 TTGGAGACTCAGAGACAGACAGG - Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035964380 8:4174089-4174111 AGGGAGACTCACAGAGTGGAGGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036612505 8:10362558-10362580 TAGGAAACTCAGAAAGGGGATGG - Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036787890 8:11700043-11700065 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037541464 8:19875925-19875947 TCTGAGCCTCAGAGAGGAGAGGG - Intergenic
1037588246 8:20292872-20292894 ATAGAGGCCCAGAGAGGGGAAGG - Intronic
1038262768 8:26011742-26011764 TTGGAGAATCATAGCAGGGAGGG - Intronic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038747622 8:30268301-30268323 TTGGAGGCTCTGAGATGGGAAGG - Intergenic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1038920674 8:32080578-32080600 TTGGAAGCTCTGAGAGTGGAAGG - Intronic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041310321 8:56510115-56510137 TTGGAGCCTAAGGAAGGGGAAGG - Intergenic
1041628146 8:60054949-60054971 TTGGAGATGAAGGGAGGGGAGGG + Intergenic
1041755145 8:61305338-61305360 GTGGTTAATCAGAGAGGGGAAGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042482998 8:69324528-69324550 TTGGAGACCCAGAGAGGAGCTGG + Intergenic
1042536930 8:69868616-69868638 TTGGAAATTCAGAGAGGGAGAGG - Intergenic
1042544198 8:69936156-69936178 TTGGAAGGTCAGAGTGGGGATGG - Intergenic
1042566011 8:70112772-70112794 ATGGGGAATGAGAGAGGGGAAGG + Exonic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042847164 8:73179947-73179969 TTGGGGGCTCAGTGAGGGGAAGG - Intergenic
1043220266 8:77653912-77653934 TTGTTAACTCAGAGAGGGGTGGG - Intergenic
1043355621 8:79408858-79408880 TTGGAGACTCAGAAGGGGAGAGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045065734 8:98442249-98442271 TTGGAGAATTGGAGAGGGGAAGG - Intronic
1045135935 8:99218444-99218466 CTGTAGACTAAGAGAGGGTAAGG + Intronic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046270882 8:111896734-111896756 TGGGAGCCACAGAGAGAGGAAGG - Intergenic
1046334421 8:112766028-112766050 TTGGAAACTCAGTGAGGGAAAGG - Intronic
1046927890 8:119812478-119812500 TTGGAGACTCAGAAGCGGGGAGG - Intronic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047197772 8:122736938-122736960 TTGGAGAGGCAGAGAGAGTAAGG + Intergenic
1047316672 8:123741103-123741125 TTGGAGGCCCAGAGGGGAGAAGG + Intergenic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047891801 8:129320472-129320494 TTGGAGACTCAAAGATGACATGG - Intergenic
1048082419 8:131143045-131143067 TTGTAGATGCAGAGAAGGGAAGG - Intergenic
1048102006 8:131362531-131362553 TTGGAGACTCAGAGGGTGAGTGG + Intergenic
1048996772 8:139799490-139799512 TGGGTGATTCAGAGAGGGTAAGG - Intronic
1049414239 8:142488093-142488115 TTGGAGCCTCGGTGAGGGGCAGG - Intronic
1050195411 9:3078037-3078059 TTGGATACTCAAAACGGGGAAGG - Intergenic
1050263785 9:3869037-3869059 CTGGATACTCTGAGAGGGCAAGG + Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051208524 9:14715438-14715460 TCTGGGAATCAGAGAGGGGATGG + Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053214229 9:36257896-36257918 ATGTAGACTCAGAGCAGGGAGGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054715399 9:68552537-68552559 GCAGAGACTTAGAGAGGGGATGG + Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055672070 9:78617824-78617846 TGGGAGATTCAGAGGGTGGAAGG + Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1056678056 9:88693179-88693201 TTGGACACTCACACAGGGAAAGG - Intergenic
1056975211 9:91246515-91246537 TATGAGACTCAAAGAGGCGATGG + Intronic
1057301848 9:93891039-93891061 ATGGAGGCTCTGAGAGGAGAAGG + Intergenic
1057635487 9:96762044-96762066 TTGGAGACTTAGGGTGGGAAGGG + Intronic
1057748691 9:97772595-97772617 ACTGAGGCTCAGAGAGGGGAAGG + Intergenic
1057763464 9:97895489-97895511 TGGGAGGCTGAGACAGGGGATGG - Intergenic
1057770773 9:97965934-97965956 TAGAAGACACAGAGAGGGGATGG + Intergenic
1057889877 9:98861808-98861830 ATTGAGACTCAGAGAGGGTAAGG + Intergenic
1057936246 9:99241530-99241552 ATTGAGGCCCAGAGAGGGGAAGG + Intergenic
1057999773 9:99853083-99853105 ATTGAGATTCAGAGAGGGTAAGG - Intronic
1058026895 9:100150917-100150939 TAAGAGAACCAGAGAGGGGATGG + Intronic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058384729 9:104421045-104421067 TTGGAAATTTAGAGATGGGAAGG - Intergenic
1058582076 9:106469222-106469244 TCGGAGGCTCAGAGGGGGAAAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058608773 9:106752682-106752704 AGAGAGACTCAGAGAGGAGAAGG - Intergenic
1058704524 9:107627607-107627629 CTTGAAACTCAGAGAGGTGAAGG - Intergenic
1058726924 9:107813327-107813349 TGGTACACTCAGAGAGGGCATGG - Intergenic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059335148 9:113564480-113564502 ACCGAGGCTCAGAGAGGGGAAGG + Intronic
1059356715 9:113705449-113705471 AGGGACACTCAGAGAAGGGAGGG - Intergenic
1060191951 9:121599261-121599283 CTGGGGACTCCGGGAGGGGAGGG + Intronic
1060269755 9:122132097-122132119 ACGGAGGCTCAGAGAGAGGAAGG - Intergenic
1060333448 9:122698167-122698189 TTGGAGACTCCGAAGTGGGAAGG + Intergenic
1060418478 9:123450151-123450173 GTTGAGACTCTGAGTGGGGAGGG - Intronic
1060521004 9:124294024-124294046 TTTAAGGCTCAGGGAGGGGACGG + Intronic
1060907368 9:127318893-127318915 TTGGAGCCTCAGAGAAGTGAAGG + Intronic
1060975335 9:127761840-127761862 ATGCAGGCTCAGAGAGGTGAAGG - Intronic
1060976780 9:127769822-127769844 ACTGAGACTCAGAGAGGGGAAGG - Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061206402 9:129166416-129166438 CTGGAGGCTCAGGGAGGTGAAGG + Intergenic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1061268728 9:129524131-129524153 ATGGAGACTTAGAGATGAGAAGG - Intergenic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061456638 9:130703026-130703048 AAGGAGACACAGAGAGGGGAAGG - Intronic
1061553003 9:131348880-131348902 CTGGAGACTTACAGAGGGGTGGG + Intergenic
1061629639 9:131863972-131863994 ATGGAGACGCAGAGAGGATAAGG - Intronic
1061707189 9:132462169-132462191 TTGGAGTCGCAGAAAGGGAATGG + Intronic
1062137586 9:134937973-134937995 TTGGAGAGGCAGAGGGGGAAAGG - Intergenic
1062465659 9:136679889-136679911 TGGAAGATTCTGAGAGGGGAGGG - Intronic
1062600193 9:137315982-137316004 TGGGAGGCTCAGAGACGGGAGGG - Intronic
1185604667 X:1361176-1361198 ATGGAGAGAGAGAGAGGGGAAGG - Intronic
1185652324 X:1657427-1657449 TTGCAGAGTCAGAGAGCAGATGG + Intergenic
1185859566 X:3564982-3565004 TTGGAGACTCCGAAGTGGGAGGG + Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185943489 X:4347809-4347831 TTGGAGACTGGGAAAGGGGATGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186116142 X:6306869-6306891 TTGGATACATATAGAGGGGAAGG + Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1186915731 X:14218253-14218275 TAGGAGACTGAGGGAGGGGGTGG - Intergenic
1186997161 X:15135912-15135934 TTGGAGACTCAGGGGGGAAAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187447832 X:19373723-19373745 GGGGAGACTCAGAGAGGGACGGG + Intronic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1187589325 X:20699194-20699216 TTGGGGACTCAGGGAAAGGATGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188154577 X:26725021-26725043 TTGGAGACTCAGACATGGGGAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188188771 X:27148250-27148272 TTGGAGACTCAAAAAGTGGGAGG + Intergenic
1188206828 X:27370206-27370228 TTGGAGACTCAGAAACAGAAGGG + Intergenic
1188445408 X:30249095-30249117 CTGGGTACTCAGAGAGGTGAAGG + Intronic
1188576337 X:31655340-31655362 TTGCAGGCTCAGAGATGGAAGGG + Intronic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1188964293 X:36531897-36531919 TTGGAGACTCAGAAAGCGTTGGG - Intergenic
1189167478 X:38874955-38874977 TTGAAGACTCAGAATGGGGGAGG - Intergenic
1189237580 X:39499558-39499580 TTGGAGACTCAGAAGTGGGGAGG - Intergenic
1189268921 X:39736686-39736708 TTGGAGGCTCAGAGAGTGGGTGG - Intergenic
1190029969 X:46962674-46962696 TTGGAGACTAAGAGAAGCAAAGG + Intronic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191706840 X:64102794-64102816 TTGGAGGCTCTGGGAGGGCAGGG + Intergenic
1191769991 X:64744615-64744637 TTGGGGATTCAGGTAGGGGAAGG - Intergenic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192215794 X:69157209-69157231 TGGGAGACACAGAGAGGAAAGGG + Intergenic
1192284389 X:69719505-69719527 TTGGAGACTCAGAAGTGGGGAGG - Intronic
1192290745 X:69792118-69792140 TTGGGGACTCAGTGGGGGAATGG - Intronic
1192884445 X:75321994-75322016 TTGGAGACTGAGAAGGGGTAGGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194145648 X:90258690-90258712 TTGGAGATTCAGGAGGGGGAAGG + Intergenic
1194228439 X:91291606-91291628 TTGGAGACTCAGAAGTGGGTAGG - Intergenic
1194269102 X:91787939-91787961 TTATAGACTCTGAGAGTGGAAGG + Intronic
1194465139 X:94225357-94225379 TTGGAGACTCAGAAACGGTGAGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195372456 X:104191472-104191494 TAGGAGAACCAAAGAGGGGAAGG - Exonic
1195672524 X:107481949-107481971 ACCGAGACTCAGTGAGGGGAAGG + Intergenic
1195969856 X:110461343-110461365 TTGGAGACTCAGAGAAATGTTGG + Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196778100 X:119359613-119359635 TGGCAGACTCAGGGAGTGGAGGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197163299 X:123347612-123347634 ATGGAGCCTCCGAGTGGGGAGGG - Intronic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197760482 X:130024530-130024552 TTGGGGTCTCAGACAGGGCAAGG - Intronic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198134421 X:133733273-133733295 TTAGGGACTCAGAAGGGGGAGGG + Intronic
1198166788 X:134065428-134065450 TTGGAGAGGCAGTGTGGGGAGGG - Intergenic
1198412883 X:136389636-136389658 CTCGAGTCTCAGAGAGGGGAAGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198859340 X:141052917-141052939 AGAGAGATTCAGAGAGGGGATGG - Intergenic
1198903355 X:141534475-141534497 AGAGAGATTCAGAGAGGGGATGG + Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199110821 X:143931843-143931865 TTGGAGATTCAGAAGGGGAAGGG - Intergenic
1199242274 X:145561180-145561202 TTGGAGACTTAGAAGGGGAAGGG + Intergenic
1199710807 X:150467790-150467812 TCTGAGACCCAGAGAGGGGCAGG - Intronic
1200101178 X:153689658-153689680 TAGGAGGCCCAGAGAGGAGAAGG + Intronic
1200282050 X:154785241-154785263 ATGGACACTCAGAGAGTGAAGGG - Intronic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1201398708 Y:13578624-13578646 TTGGAAACTCAGAATAGGGAAGG + Intergenic
1201481110 Y:14440572-14440594 TTGGATACATATAGAGGGGAAGG - Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic