ID: 1101949622

View in Genome Browser
Species Human (GRCh38)
Location 12:109164531-109164553
Sequence CTGTGTGTGAAATGCTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101949622_1101949630 14 Left 1101949622 12:109164531-109164553 CCTTCCTAGCATTTCACACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1101949630 12:109164568-109164590 TGAATGTGAGGGCAGGAGAAAGG 0: 1
1: 0
2: 2
3: 71
4: 641
1101949622_1101949631 28 Left 1101949622 12:109164531-109164553 CCTTCCTAGCATTTCACACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1101949631 12:109164582-109164604 GGAGAAAGGCTGAAGTGCAATGG 0: 1
1: 0
2: 3
3: 72
4: 679
1101949622_1101949625 -10 Left 1101949622 12:109164531-109164553 CCTTCCTAGCATTTCACACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1101949625 12:109164544-109164566 TCACACACAGCCAAGTGGTAAGG 0: 1
1: 0
2: 0
3: 7
4: 152
1101949622_1101949628 3 Left 1101949622 12:109164531-109164553 CCTTCCTAGCATTTCACACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1101949628 12:109164557-109164579 AGTGGTAAGGTTGAATGTGAGGG 0: 1
1: 0
2: 3
3: 11
4: 177
1101949622_1101949629 7 Left 1101949622 12:109164531-109164553 CCTTCCTAGCATTTCACACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1101949629 12:109164561-109164583 GTAAGGTTGAATGTGAGGGCAGG 0: 1
1: 0
2: 1
3: 14
4: 162
1101949622_1101949627 2 Left 1101949622 12:109164531-109164553 CCTTCCTAGCATTTCACACACAG 0: 1
1: 0
2: 0
3: 14
4: 225
Right 1101949627 12:109164556-109164578 AAGTGGTAAGGTTGAATGTGAGG 0: 1
1: 0
2: 0
3: 13
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101949622 Original CRISPR CTGTGTGTGAAATGCTAGGA AGG (reversed) Intronic
901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG + Intronic
901834336 1:11914107-11914129 CAGTGGGTTTAATGCTAGGAGGG + Intergenic
902943625 1:19817959-19817981 CTGTTTGTGAGACCCTAGGATGG + Intergenic
903029109 1:20450196-20450218 ATTTATGTGAAATTCTAGGAAGG + Intergenic
904433114 1:30477858-30477880 CTGTGTCTGAAGTGGTGGGAGGG - Intergenic
904466736 1:30712511-30712533 GTGTGTGTGAGATGATGGGAAGG - Exonic
905935086 1:41817098-41817120 CTATGTGTTAAGTGCTATGATGG - Intronic
906713998 1:47953502-47953524 TTGTCTGAGAAATGGTAGGACGG - Intronic
908145080 1:61233112-61233134 ATGTCTGTGAAAGGCAAGGAGGG - Intronic
910096722 1:83531068-83531090 CTGTGTTTGAAAAACTAGCATGG - Intergenic
911221298 1:95250248-95250270 CTGTGTGTGAAATGGGGAGAGGG + Intergenic
911716631 1:101140807-101140829 ATGTGTGTGAGATGCTAGTGAGG + Intergenic
912394550 1:109331285-109331307 CTATCTGTGGAATGCAAGGATGG + Intronic
914084923 1:144444874-144444896 CAGTGTGTAAATTCCTAGGAAGG + Intronic
914454397 1:147822337-147822359 CTGTCTCTGAGATGGTAGGAAGG - Intergenic
914933227 1:151953303-151953325 CTGTGTGGGAAATGCATGAAGGG + Intergenic
916437251 1:164788531-164788553 CTGTGTCTGTAATGCTTGGAGGG - Intronic
916866997 1:168870731-168870753 TTGTGTGTGTAATGTAAGGAAGG - Intergenic
917080327 1:171251551-171251573 CTGTGTGAGGAATGCTGTGAAGG - Intronic
919884500 1:201923276-201923298 CTGTGTGTCAAATTCCAGGATGG - Intronic
920204840 1:204283903-204283925 CTGTGTGTGAGGTGCTGGGCAGG - Intronic
920970057 1:210735456-210735478 GTGTGTGTGTGATGCTGGGATGG + Intronic
921725478 1:218518693-218518715 CTTTGTGTTAAATGCAAAGATGG - Intergenic
922997177 1:229973364-229973386 CTTAGTGTGAACTGCCAGGAAGG - Intergenic
1064963492 10:20992342-20992364 CTGTGTCTGAACTGCAAGGGCGG - Intronic
1065137234 10:22683822-22683844 GTGTGTGTGAACTGCTTGGTAGG - Intronic
1065150697 10:22820078-22820100 CTATTTGTGATATACTAGGAAGG + Intergenic
1065164260 10:22958413-22958435 CTGTGTGTGTGTTGCTGGGAAGG - Intronic
1068023704 10:51616880-51616902 CTGTGACTGAAATGCAAGCAAGG - Intronic
1068132980 10:52918305-52918327 CAGTGTGTGAAATAGGAGGATGG - Intergenic
1069373527 10:67771169-67771191 ATGTGTGTGAGATGGTGGGAAGG - Intergenic
1069631847 10:69902027-69902049 GTGTGTGAGAAGGGCTAGGAGGG + Intronic
1072838881 10:98747870-98747892 CTGTGTGTTAGATGCTATGAAGG - Intronic
1074890870 10:117735666-117735688 CTGGATTTGAAATGCCAGGATGG + Intergenic
1076118380 10:127917030-127917052 CTGTGTGTGGAAAGCCAGAATGG + Intronic
1076402549 10:130193520-130193542 CTGTGGGTGAAAGGGCAGGAGGG - Intergenic
1076514598 10:131036830-131036852 TGGTGAGTGAAATGTTAGGACGG - Intergenic
1078602317 11:12744476-12744498 CTGACTGTGAAATGTTAGGTGGG + Intronic
1078698992 11:13662851-13662873 CTGTGTAGGAGATTCTAGGAAGG - Intergenic
1078721341 11:13886725-13886747 CTGAGTGTGAAATGATACAATGG - Intergenic
1079951588 11:26811946-26811968 CTGGGTCAGAAATTCTAGGATGG + Intergenic
1080132174 11:28809307-28809329 CTTTGTGTAAAGTGCTAGAATGG - Intergenic
1083016439 11:59459012-59459034 CTGAGGGTGAAATGTAAGGAGGG - Intergenic
1084341192 11:68502871-68502893 CTGTGTTTGAAATGCCATGATGG + Intronic
1084935127 11:72582837-72582859 CTGTGTATGAAATGCTGCCATGG - Intronic
1086046987 11:82544633-82544655 CTATATGAGAAATGCAAGGATGG + Intergenic
1090764592 11:129865572-129865594 GGGTGTGGGAAGTGCTAGGATGG - Intronic
1091358419 11:134955996-134956018 CAGTGTTTGAAATGCTCGAAGGG - Intergenic
1096409696 12:51368251-51368273 CTGTGTGTGAGATCCCGGGAGGG + Intronic
1096842679 12:54389227-54389249 CTGGGTGTCACATGCTAGGCAGG + Intronic
1097682323 12:62660227-62660249 CTGTGTGTAATTTGGTAGGAGGG - Intronic
1098302385 12:69067405-69067427 GTGAGTGTAAAATGCAAGGACGG + Intergenic
1100413803 12:94351180-94351202 TTGTGTGAGAAATGGTAGGTAGG + Intronic
1100788317 12:98102417-98102439 CTCTGTGGGAAATGGTGGGAAGG + Intergenic
1101130773 12:101689129-101689151 ATGTGTGTATCATGCTAGGATGG + Intergenic
1101850599 12:108399103-108399125 CCCTGTGTGAAATGCTGAGAGGG + Intergenic
1101949622 12:109164531-109164553 CTGTGTGTGAAATGCTAGGAAGG - Intronic
1102147638 12:110666912-110666934 ATGTGAGGTAAATGCTAGGAGGG - Intronic
1102432845 12:112897119-112897141 GTGTGTGTTCAAGGCTAGGAGGG - Exonic
1102759806 12:115375365-115375387 CTGTGGGTGACATGATAAGAAGG + Intergenic
1103349860 12:120276652-120276674 CTGGGTGTGGAAAGCGAGGACGG - Intergenic
1103861203 12:124015805-124015827 CTGTGTGTGAAAATCGAGGTTGG - Intronic
1107391739 13:39972096-39972118 CTCTGTGTAAAATGTAAGGAAGG - Intergenic
1110850103 13:80235555-80235577 CTGTTTGTGAAAAGAAAGGAGGG - Intergenic
1110860913 13:80343213-80343235 CTGGGTGTGCAAGGCTAGGCAGG + Intergenic
1111841784 13:93458345-93458367 CTGTGTGATAAATGCTACTAAGG - Intronic
1117060935 14:51962773-51962795 CTGTGTGCAAAATGTTAGCAGGG + Intronic
1117320099 14:54613389-54613411 TTGTGTGTGATATGCCAGGCTGG + Intronic
1117943022 14:60989321-60989343 CTATTTGTAAAATGATAGGAAGG - Intronic
1118596165 14:67437176-67437198 CTATGTGTGAAATGCTGTGCTGG + Intergenic
1121204221 14:92148435-92148457 CAATGGGTGAAATGGTAGGATGG - Intronic
1121452924 14:94020847-94020869 AACTGTGAGAAATGCTAGGATGG + Intergenic
1121662370 14:95645074-95645096 CTGTGTGTGAAGTGCTGTGCTGG + Intergenic
1122656131 14:103260611-103260633 CTGTGTGGGAAATGCCCGGGGGG - Intergenic
1123149192 14:106165192-106165214 CTGTGTGAGAAATCCTGTGAGGG - Intergenic
1128719883 15:69940511-69940533 CTGTGTGTGAGGTGGTTGGAGGG - Intergenic
1129154829 15:73711215-73711237 CTGTGTGTGAGAGGCTGAGAGGG + Intronic
1129174820 15:73832409-73832431 CTGTCTGTGAAGTCATAGGAGGG + Intergenic
1129764757 15:78156169-78156191 ATGCGTTTGAAATGCTAGCATGG - Intronic
1130887677 15:88107727-88107749 CTGTGTGTGAAATCCTCTGCAGG + Intronic
1132088191 15:98924841-98924863 CTGTGTGTGAAAGGTTGGGCAGG + Intronic
1136681028 16:31962372-31962394 CTGTGTGAGAAATCCTGTGAGGG + Intergenic
1136781345 16:32903885-32903907 CTGTGTGAGAAATCCTGTGAGGG + Intergenic
1136888452 16:33949955-33949977 CTGTGTGAGAAATCCTGTGAGGG - Intergenic
1137061866 16:35798260-35798282 CTGTGTGAGAAACACTGGGAAGG + Intergenic
1138061463 16:53895490-53895512 CTGTGTGTGAAATTCTCTAAAGG - Intronic
1138821521 16:60265907-60265929 TTGTGTGAGAAATAATAGGAGGG - Intergenic
1141239854 16:82255576-82255598 CAGTGTGTTGAATGCTATGATGG + Intergenic
1141387050 16:83631435-83631457 CTGTGTTTGAAATCACAGGATGG - Intronic
1142023220 16:87797186-87797208 CTGTGGCTCAAATGCCAGGAGGG + Intergenic
1142169492 16:88614002-88614024 GTGGGGGTGAAATGCAAGGAGGG + Intronic
1143669570 17:8387168-8387190 CTGTTTCTGAAAAGCTAGGTAGG + Intergenic
1144018135 17:11216412-11216434 CTGTCTGAGAAATGGGAGGATGG - Intergenic
1144078136 17:11737334-11737356 GTGTGTGTGAAACGGTGGGAGGG - Intronic
1146393081 17:32440768-32440790 GACTGTGTTAAATGCTAGGAAGG + Intergenic
1146526518 17:33571597-33571619 AAATGTGTGAAATGCTATGAAGG + Intronic
1152011853 17:77723801-77723823 CTGTGTGTGAACAGCCAGGCTGG + Intergenic
1153368824 18:4290090-4290112 CTGTGTTTGAAAAGCTTGCAGGG - Intronic
1157574371 18:48733767-48733789 CTGAGTGTGAAGAGCCAGGAGGG - Intronic
1158183167 18:54741246-54741268 CTGTGGGTGACATGGTGGGATGG - Intronic
1158244571 18:55416943-55416965 CTGAGAGTGAAATGCAAGAAAGG + Intronic
1158852348 18:61507605-61507627 ATGTTTATGAAATGCTAGTAAGG + Intronic
1160479684 18:79227376-79227398 GTGTGTGTGAATTGCATGGATGG + Intronic
1161023554 19:2023691-2023713 CTGTGTGTGAAAAGCCATGAAGG + Intronic
1166230144 19:41421793-41421815 CAGTGTGTGAAGGGCTAGTAAGG + Intronic
1168189874 19:54730111-54730133 CTGTGGGTGACAGGCCAGGATGG - Intronic
928108874 2:28490493-28490515 CTGAGTCTGAAATGGTAAGAGGG + Intronic
929783472 2:44972728-44972750 CTTTGCCTGAAATGCTAGGGTGG - Intergenic
930612848 2:53562594-53562616 CTCTGAGTGCAATCCTAGGATGG + Intronic
932803660 2:74764977-74764999 CTGAGTGTGAAATGAGAGGGGGG + Intergenic
932855493 2:75229682-75229704 CTGTGGCTGAAATGCTGTGAGGG + Intergenic
933152709 2:78934276-78934298 CTATGTGTCAAATGCTCTGAAGG + Intergenic
935156285 2:100486401-100486423 ATGTGTGTTCAATGCAAGGAGGG + Intergenic
935328487 2:101959598-101959620 ATGTGGGTGATATGGTAGGATGG - Intergenic
936168995 2:110151197-110151219 CTGCATGTGAAATGCTTGTATGG - Intronic
937103038 2:119286329-119286351 CTGGCTGTGAAGTGCTGGGAAGG + Intergenic
938937740 2:136142188-136142210 CTGTTTGTAAAATGCTGTGAAGG + Intergenic
939006410 2:136792571-136792593 CTGTGGGTGGAATGCTGGGGAGG + Intronic
940665679 2:156606220-156606242 CTGAGTGTCAAATGCTATTATGG - Intronic
941248033 2:163125186-163125208 CAGTGTGTGAAGTGCTGGGGAGG + Intergenic
943242592 2:185405096-185405118 ATGTTTGTGACATGCTATGATGG - Intergenic
943482050 2:188430923-188430945 CTGTGTGGGAAAAGCCAGCAAGG - Intronic
944148704 2:196534422-196534444 GTGAGTGTGAAATACTAGGGAGG + Intronic
944172703 2:196797352-196797374 CTGTGTGTGAAGTTCCATGAGGG + Intronic
944183288 2:196919872-196919894 CTGTGTGTGAAGTGCTGTGCTGG - Intronic
944658244 2:201898376-201898398 CTGCTTCTGAAATGCTAGCAAGG + Intergenic
948026616 2:234783140-234783162 GTGTGTGTGAAATAGTAGGTGGG - Intergenic
948056910 2:235015533-235015555 CTCTGTGGGGAATGCAAGGATGG + Intronic
948917281 2:241040695-241040717 CCATCTGTGAAATGCCAGGAGGG + Intronic
1169159608 20:3365690-3365712 CTGTGGGTAAAATGCTATCACGG - Intronic
1171255532 20:23686696-23686718 ATGTGTTTGATTTGCTAGGAAGG - Intronic
1171262870 20:23748623-23748645 ATGTGTTTGATTTGCTAGGAAGG - Intronic
1172870190 20:38130972-38130994 CTGTGTGGGAGATGAGAGGAGGG + Intronic
1173241145 20:41298365-41298387 CAGTGAGTGACATGCTATGAGGG + Intronic
1174845698 20:53941120-53941142 GTGTGTGTGAAGTGGGAGGAGGG + Intronic
1177812051 21:25935103-25935125 CTGTGTGTCAAATGCCTGGCGGG + Intronic
1179266591 21:39809085-39809107 CTTTGTGTGAAAAGCAAGGAAGG + Intergenic
1181358830 22:22319400-22319422 CTGCCTGTGAAATGCGAGCAAGG - Intergenic
1183381709 22:37493532-37493554 CTGTGTGTGGTGTGCTTGGAGGG - Intronic
1184287945 22:43482580-43482602 CTTTCTGTGAAATGCCAAGAGGG + Intronic
1184882592 22:47319970-47319992 CTGCGTGTGAATTTCTTGGATGG + Intergenic
949223921 3:1670738-1670760 CTGTGTTTGCATTGCTATGAAGG + Intergenic
949278481 3:2317732-2317754 CAGTTTGTAAAATGCTAGGTAGG + Intronic
949366202 3:3283938-3283960 CTGTATGTGAAACTCTAGGTTGG + Intergenic
949493303 3:4609583-4609605 CTGGATGGGAAATGCTGGGATGG + Intronic
949695696 3:6692610-6692632 CAGTGTGTGAAATTCTGTGATGG - Intergenic
950666947 3:14503489-14503511 GTGTGTGTGCAATGGGAGGAAGG - Intronic
950900700 3:16494864-16494886 CTGTGTGTGATATTCTTGGCTGG - Intronic
951393286 3:22133378-22133400 CTGTGTGTGAAAGACAGGGAGGG + Intronic
952704372 3:36362308-36362330 CTGTGTGGGAAATCCCAGGGTGG + Intergenic
955203652 3:56875899-56875921 CTGGGTGATAAAGGCTAGGATGG + Intronic
955476678 3:59343449-59343471 CTGGGTGTCAAATGGCAGGAAGG - Intergenic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
956151911 3:66252618-66252640 TTGTGTGTCAGATGCTAGGCTGG - Intronic
956689193 3:71860543-71860565 TTGTGTGTGGAATCATAGGAAGG - Intergenic
958863865 3:99477525-99477547 TTGTGTGTGAAATTATAGGTTGG + Intergenic
960353870 3:116627374-116627396 CTGGGTGTAATATGCTAGGTTGG + Intronic
963347500 3:144112826-144112848 CTTTGTGTTAAATGCTAAGAAGG + Intergenic
964004665 3:151812835-151812857 AAGAGTGTGAAATGCCAGGATGG - Intergenic
970144766 4:13023743-13023765 TTGTGTATGAAGTGCAAGGATGG - Intergenic
970953853 4:21787685-21787707 CTGTGTGTGAAACGTTATAATGG - Intronic
973216773 4:47678041-47678063 CTGGCTGTGACAGGCTAGGAAGG + Exonic
974688791 4:65268404-65268426 TTGTGTATTATATGCTAGGATGG - Intergenic
975060424 4:69990512-69990534 CTGTGTGTCAAATGCTATTTTGG + Intergenic
977989566 4:103424551-103424573 CTGTCTGAGGAATGGTAGGAAGG + Intergenic
979250209 4:118559648-118559670 ATTTATGTGAAATTCTAGGAAGG + Intergenic
979373841 4:119921082-119921104 CTGAGAGTGAAATGCTTGCAGGG - Intergenic
981316364 4:143343534-143343556 CCATGTGTGGAATGCAAGGAAGG + Intronic
984053664 4:174898817-174898839 CTGTGGGGGAAATTGTAGGAGGG - Intronic
984463758 4:180070975-180070997 CTGTAAGTGAAAGGCCAGGATGG - Intergenic
984564321 4:181309498-181309520 GTGTGTGTGAGATGGTGGGATGG + Intergenic
984583271 4:181534676-181534698 CTGTGTGGTAAATGCCATGAAGG - Intergenic
984653338 4:182291869-182291891 CTGTGTGTGTAGGGCTGGGAGGG + Intronic
985499715 5:235216-235238 CTGTCTCTGAAATGCCAGGCAGG - Exonic
986031030 5:3892694-3892716 CTGTGTGTCAAAAGCTTGGCAGG + Intergenic
986327513 5:6687324-6687346 CTGTATCTGAAACGCTGGGACGG + Intergenic
987600453 5:20061943-20061965 CAGTGTGTGACATGCAATGAGGG - Intronic
988484107 5:31654224-31654246 GTGTGTGTCAAATGCTTTGAGGG - Intronic
991494902 5:67217160-67217182 CTGTGTGTAGAATGGTGGGATGG + Intergenic
992760553 5:79947746-79947768 CTGAATTTGAAATGCTTGGATGG + Intergenic
995190328 5:109312624-109312646 CTGTGTGTGAAATGATGAAATGG - Intergenic
995271701 5:110227592-110227614 CTGAGACTGAAATGCTAGCAGGG + Intergenic
997875554 5:137543651-137543673 CTGTGTGTGTAAGGAGAGGAGGG + Intronic
998534951 5:142921139-142921161 GTGGATGTGAAATGCTAGGTTGG - Intronic
998738070 5:145165916-145165938 TTGTCTGTGAAATGAAAGGATGG - Intergenic
1000196483 5:158963978-158964000 CAGTGTGAAAAATGCTATGACGG + Intronic
1003333000 6:5145118-5145140 GTGTGTGTGAAATGCCAGGTTGG - Intronic
1006566102 6:34958885-34958907 CAGTGTGTGACATTCTGGGAAGG - Intronic
1007020576 6:38516570-38516592 CAGTAGGTGACATGCTAGGAAGG + Intronic
1007546412 6:42698119-42698141 CTGTGTGTCAAATGCTTTTAGGG + Exonic
1010276773 6:73977302-73977324 CTGGGTATGAAATTCTGGGATGG + Intergenic
1011203666 6:84867742-84867764 GTATGTGAGTAATGCTAGGAAGG + Intergenic
1012265028 6:97131471-97131493 CTCTGTGGTAAATGCTTGGATGG - Intronic
1013062644 6:106651689-106651711 CTGTATCTGAATTTCTAGGAGGG + Intronic
1014594449 6:123316140-123316162 CTGTTTATGAAATGCTAAGAGGG - Intronic
1014744101 6:125179540-125179562 CTGCTTGTGAAATGCTTTGAGGG - Intronic
1014768764 6:125437405-125437427 GTGAGTGAGAAATGCCAGGAGGG + Intergenic
1014927651 6:127293419-127293441 CTGGGCTTGAAATCCTAGGATGG + Intronic
1016364392 6:143299949-143299971 CAGTGTCAGAAATGCTATGATGG - Intronic
1016511544 6:144848669-144848691 CTTTGTGTGAATGGCTAAGAAGG + Intronic
1017897204 6:158690998-158691020 CTGTGTGTGTGAGGCCAGGAAGG - Intronic
1021954695 7:25812706-25812728 CTGTGTCTGAAATGAGAGGGAGG - Intergenic
1023088914 7:36599958-36599980 GTGTGTGTGAAAGCCAAGGAAGG - Intronic
1023712444 7:43009364-43009386 CTATGGGTGAAATGAGAGGAAGG - Intergenic
1023972535 7:45001669-45001691 CTGTGTGTGATAGGCAAGGATGG + Intronic
1025127377 7:56354846-56354868 CTGTTTATGAAATACTGGGAAGG + Intergenic
1026517541 7:71086008-71086030 CTCTGTGTGAGGTGCTAGGTAGG - Intergenic
1028492458 7:91427290-91427312 CTTTTTGTGAAATGAGAGGAGGG + Intergenic
1030372918 7:108720560-108720582 CTGTCTCTGAAATGCTGGGAGGG + Intergenic
1031534639 7:122918041-122918063 CTGTGTCTGAGATGTTAGGAAGG + Intergenic
1032099843 7:128965394-128965416 CTTGGTGTGAAATGCTAAGATGG + Intronic
1033155537 7:138954033-138954055 CTATGTGCAAAATGCTAGCAAGG + Intronic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1034712405 7:153205138-153205160 CTTTGTGTGAAATCCTAGCCTGG + Intergenic
1038116903 8:24566662-24566684 CTGGGTGTAAAATTCTAGGTTGG + Intergenic
1041396442 8:57396493-57396515 TTGTGTGTGTCATGTTAGGATGG + Intergenic
1041525126 8:58796795-58796817 CTGTGTGTGGGATGAAAGGAGGG + Intergenic
1042344516 8:67713694-67713716 CACTGTGTCAAATGCTATGATGG - Intronic
1045827199 8:106412314-106412336 CTGTGCTTCAAATGGTAGGATGG + Intronic
1047493197 8:125390750-125390772 CCCTGTGTTAAATGCTATGATGG - Intergenic
1047631926 8:126716736-126716758 CCCTGTGTGAAAAGATAGGAAGG + Intergenic
1049137636 8:140918328-140918350 ATGTTTTTGAAAGGCTAGGAAGG - Intronic
1049956537 9:698262-698284 CTGTGTTTGAAACTCTAGGATGG - Intronic
1051922834 9:22287786-22287808 CTGTTTTTGAAATGTTATGATGG + Intergenic
1055173204 9:73286030-73286052 CTGTTTGTTAAATGCCTGGAAGG + Intergenic
1056186878 9:84143591-84143613 GTGTGTGGGAAATGGCAGGAGGG + Intergenic
1057440721 9:95081258-95081280 CTGCCTGTGAACTCCTAGGAAGG - Intronic
1058920268 9:109607621-109607643 CTGTGGGTAAAATGCTATCAAGG + Intergenic
1060974822 9:127758707-127758729 CCATGTATGAAATGCTAGAAAGG - Intronic
1185536632 X:867819-867841 GTGTGTGTGAAATTCTGGAAAGG + Intergenic
1187575408 X:20548846-20548868 CTGGGTGTGGAAGACTAGGAAGG - Intergenic
1190506223 X:51128874-51128896 CTGTGTATGAAATTCTGGGTTGG + Intergenic
1194085009 X:89515867-89515889 CTGTGTGGGAAATGCATGAAGGG - Intergenic
1195162118 X:102181154-102181176 CTGTGTGAGGAATGCTACAAAGG - Intergenic
1197101875 X:122665587-122665609 CTGTTTGAGAAATGCGAAGATGG - Intergenic
1198683954 X:139208236-139208258 CTGTGTGGGAAAGGCTGGGTGGG - Intronic
1200437658 Y:3171752-3171774 CTGTGTGGGAAATGCATGAAGGG - Intergenic
1202233088 Y:22676181-22676203 CTGACTGTGAAATCCTAGGGTGG + Intergenic
1202310068 Y:23519977-23519999 CTGACTGTGAAATCCTAGGGTGG - Intergenic
1202560733 Y:26150616-26150638 CTGACTGTGAAATCCTAGGGTGG + Intergenic