ID: 1101953442

View in Genome Browser
Species Human (GRCh38)
Location 12:109193969-109193991
Sequence GGTAACAAGGTACCACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2229
Summary {0: 1, 1: 8, 2: 103, 3: 547, 4: 1570}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101953442 Original CRISPR GGTAACAAGGTACCACAAAC TGG Intronic
Too many off-targets to display for this crispr