ID: 1101953969

View in Genome Browser
Species Human (GRCh38)
Location 12:109197595-109197617
Sequence CACACTGAACAAACAGATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101953966_1101953969 -2 Left 1101953966 12:109197574-109197596 CCAGCCCATTCGGGAAGATGACA 0: 1
1: 0
2: 2
3: 8
4: 68
Right 1101953969 12:109197595-109197617 CACACTGAACAAACAGATAGTGG 0: 1
1: 0
2: 2
3: 19
4: 214
1101953968_1101953969 -7 Left 1101953968 12:109197579-109197601 CCATTCGGGAAGATGACACACTG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1101953969 12:109197595-109197617 CACACTGAACAAACAGATAGTGG 0: 1
1: 0
2: 2
3: 19
4: 214
1101953967_1101953969 -6 Left 1101953967 12:109197578-109197600 CCCATTCGGGAAGATGACACACT 0: 1
1: 0
2: 0
3: 9
4: 67
Right 1101953969 12:109197595-109197617 CACACTGAACAAACAGATAGTGG 0: 1
1: 0
2: 2
3: 19
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101953969 Original CRISPR CACACTGAACAAACAGATAG TGG Intronic
901288607 1:8103858-8103880 CACACAAAAAAAACAGATAAAGG - Intergenic
902751541 1:18515538-18515560 GTCACTAAACAAACATATAGGGG + Intergenic
903139903 1:21333172-21333194 CACACTGAACAAACAGGTATTGG + Intronic
904499220 1:30904549-30904571 CACACTGAACTCACAGCTGGAGG + Intronic
905703837 1:40040021-40040043 CACACCGACCAAACAGGAAGTGG + Intergenic
910164697 1:84313778-84313800 CACACTGAACACAAAGGCAGAGG - Intronic
910516994 1:88073139-88073161 CAGAATGAACAAAGAGCTAGGGG - Intergenic
911679836 1:100702643-100702665 CACACAGAACAAAAAGAAACCGG + Intergenic
912363207 1:109112155-109112177 CACACATAACAAACATATTGTGG + Intronic
912887957 1:113496430-113496452 CACATTTAACAAACACATATAGG - Intronic
917124181 1:171671103-171671125 CAGAAGGAACAAACAGGTAGTGG - Intergenic
917255034 1:173105653-173105675 CACACTGAACTTACAGAAAATGG - Intergenic
917916516 1:179707849-179707871 CACACAGAATAAACAGCTTGTGG - Intergenic
918531455 1:185526806-185526828 CACACAGAAGAAACAGAAAGGGG - Intergenic
919067047 1:192705606-192705628 CAAATAGAACAAAAAGATAGAGG + Intergenic
920423973 1:205858546-205858568 CACACTGACCAAAAAGAAACTGG - Intergenic
920646145 1:207805869-207805891 CCCACTGAACAAACAGACACTGG + Intergenic
922446822 1:225704849-225704871 CAAACTGAACAGAGAGAGAGAGG + Intergenic
924644623 1:245866293-245866315 CACACAGCACATACACATAGAGG - Intronic
1069491854 10:68867733-68867755 CACACTGACCAGACAGTTACAGG + Intronic
1069941309 10:71957403-71957425 CACACTGACCAAACAGAAACTGG - Intergenic
1070447873 10:76525457-76525479 CAAAGTGAACAAACAGGTAAAGG - Intronic
1070859069 10:79635336-79635358 TACATTGAACAAACAAATCGGGG + Intergenic
1072211969 10:93254392-93254414 GACACTGAACAAACAGGGAGAGG + Intergenic
1072863770 10:99035887-99035909 CACATTTAACATCCAGATAGTGG + Intronic
1074386228 10:113018829-113018851 TACACTGGACAAACAGATCCCGG - Intronic
1075201080 10:120404744-120404766 AGAACAGAACAAACAGATAGAGG + Intergenic
1076030140 10:127150340-127150362 CCCACTGAGCAAAGAGAAAGGGG - Intronic
1076244661 10:128937406-128937428 CAGACAGAACAAAAAGAGAGAGG - Intergenic
1076821452 10:132941997-132942019 CACACAGAACAAACAGGTCTGGG + Exonic
1079255128 11:18821323-18821345 CACACTGAGCAAACCGAAACTGG + Intergenic
1079774857 11:24512219-24512241 CAGGCTGAAAAAACAAATAGCGG + Intronic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1081250768 11:40830464-40830486 TACACTGAACAAAGAGTAAGTGG + Intronic
1083346809 11:61999404-61999426 CACACTGAACAAAGAAAGACAGG - Intergenic
1085117884 11:73946463-73946485 CACACTGACCAAACAGAAACTGG + Intergenic
1086219093 11:84420080-84420102 CACACAGAATAAACAGAAACAGG + Intronic
1088012969 11:105025466-105025488 CACACTGAAGAAACAGGGACTGG - Intronic
1089546679 11:119232191-119232213 CACACAGAACAAACAACTAGGGG - Intronic
1089659588 11:119977398-119977420 CTCACTAAACAAAAAGATAACGG + Intergenic
1091336710 11:134774847-134774869 CAAACAGAACAACCAGACAGAGG + Intergenic
1096040109 12:48507788-48507810 CACACTGACCAGACAGAAACTGG - Intronic
1098010133 12:66042132-66042154 CACACAGATCAAAAAGATAAAGG - Intergenic
1101339731 12:103832152-103832174 CACGCTGAAAAAAAATATAGAGG - Intronic
1101404670 12:104417553-104417575 CAAACTGAACATACATATACAGG + Intergenic
1101856546 12:108448251-108448273 CACCCTGGACAAACAGAAATCGG - Intergenic
1101951533 12:109179896-109179918 CACTGTGAAGAAACAGAAAGAGG - Exonic
1101953969 12:109197595-109197617 CACACTGAACAAACAGATAGTGG + Intronic
1108375426 13:49809712-49809734 CATACTGAAGTAACAGATAATGG + Intergenic
1109589335 13:64457331-64457353 AACACTGAAAAAACTAATAGAGG - Intergenic
1109872191 13:68346637-68346659 TACAATGAACAACCAAATAGAGG - Intergenic
1110054456 13:70948295-70948317 AACACTGAACAATAAGAAAGAGG - Intergenic
1111258759 13:85707683-85707705 CAAAATGAACAAACAGATGTTGG + Intergenic
1113895872 13:113764288-113764310 CACACTGAATAAACCTAGAGGGG - Intronic
1116226344 14:42157826-42157848 CACATTGAACTGACAGAGAGAGG - Intergenic
1117755685 14:58971910-58971932 AACACTGAGCAAACAGATTCTGG - Intergenic
1118985181 14:70748259-70748281 CACACTGAGGGAACAGAAAGGGG + Intronic
1119723158 14:76905009-76905031 CACACTGAGAAAACACTTAGGGG + Intergenic
1120728252 14:87971125-87971147 CAAACTGACCAACCAGATAAGGG + Intronic
1122320805 14:100854678-100854700 CACCCTGTACAATCAGTTAGTGG + Intergenic
1122642864 14:103170957-103170979 CACACTGACCAAACAGAAACTGG - Intergenic
1123666601 15:22613431-22613453 GACATTGAACATACAGAAAGAGG - Intergenic
1123984939 15:25636937-25636959 CACACTGACCAGACAGTTACAGG - Intergenic
1124320444 15:28708004-28708026 GACATTGAACATACAGAAAGAGG - Exonic
1124482070 15:30087406-30087428 GACATTGAACATACAGAAAGAGG + Exonic
1124488528 15:30139506-30139528 GACATTGAACATACAGAAAGAGG + Exonic
1124558005 15:30745824-30745846 CACACTGAACACAGGGATAAGGG - Intronic
1124673236 15:31659820-31659842 CACACTGAACACAGGGATAAGGG + Intronic
1124755000 15:32398816-32398838 GACATTGAACATACAGAAAGAGG - Exonic
1125900859 15:43345587-43345609 CAAACTGAAGAAACAAATACAGG + Intronic
1126073783 15:44888576-44888598 CACAGTGAACAAGGAGAGAGTGG + Intergenic
1126084406 15:44998278-44998300 CACAGTGAACAAGGAGAGAGTGG - Intergenic
1126588936 15:50319950-50319972 CACACTAAACATTTAGATAGTGG - Intronic
1127203244 15:56681874-56681896 CAACCTGAACAAACACAGAGTGG + Intronic
1127289519 15:57557604-57557626 CTCACTGAACAAAAAGGTGGGGG + Intergenic
1127797817 15:62453765-62453787 CACACAGAAAACACAGAGAGAGG - Intronic
1130128387 15:81114532-81114554 CAATCTAAACAAACAGAGAGAGG + Intronic
1130972255 15:88742130-88742152 CCCACTGAATCAGCAGATAGTGG + Intergenic
1131574960 15:93579401-93579423 CACAATGAGCAAACAGATTGGGG + Intergenic
1131615257 15:94009726-94009748 CACACTGAGCAAAGAGATAGAGG + Intergenic
1132279958 15:100603518-100603540 CACACTGTACAGAAAGAAAGTGG - Intronic
1136069030 16:27777222-27777244 CACCCTGAGCAAATAGAAAGTGG + Intronic
1136650009 16:31660937-31660959 CACACTGACCAAACAGAAACTGG - Intergenic
1138457304 16:57128794-57128816 CACACAGAACAGACACACAGAGG - Intronic
1138682166 16:58692912-58692934 CATACTGAAGTAACATATAGGGG - Intergenic
1142318989 16:89368918-89368940 CACACAGAACAAAGAGGCAGTGG + Intronic
1145219887 17:21079682-21079704 CACACTGACCAGACAGTTATAGG + Intergenic
1145801052 17:27685105-27685127 CACACTGAGCAGACAGTTATGGG - Intergenic
1148878777 17:50708932-50708954 CATACTAAACAAACAGACATTGG - Intergenic
1149211392 17:54305815-54305837 GACACTGAGCAAACAGAGATTGG + Intergenic
1151967867 17:77441031-77441053 GTCTCTGAACAAACAGATGGAGG + Intronic
1152332837 17:79683319-79683341 CATACAAAACAAACAGAAAGTGG + Intergenic
1153972368 18:10238110-10238132 GAGGCTGAACCAACAGATAGGGG + Intergenic
1155686936 18:28564962-28564984 AAGACAGAAAAAACAGATAGTGG + Intergenic
1155721270 18:29015084-29015106 TACACTGAACAAATAGAAATTGG - Intergenic
1158533006 18:58280323-58280345 GGCACGGAACACACAGATAGTGG - Intronic
1158801876 18:60921064-60921086 CAAACTGGACAAATTGATAGTGG - Intergenic
1159039581 18:63310898-63310920 CACACTGAAGACACACAGAGAGG - Intronic
1159379340 18:67636702-67636724 CACACTGCTCAAACATTTAGAGG + Intergenic
1159556179 18:69947299-69947321 CACACTGTACAAACAAAAACAGG + Intronic
1159582178 18:70245691-70245713 CACACTCAACCGACAGAGAGAGG + Intergenic
1159952220 18:74493029-74493051 CAAACTTAACATACAGACAGTGG - Intergenic
1162252158 19:9454764-9454786 CACACTGACCAGACAGTTATAGG - Intergenic
1162693333 19:12451555-12451577 CACACTGACCAAACAGAAACTGG - Intronic
1164422647 19:28109456-28109478 CAAACTGAATAAAAAGCTAGAGG + Intergenic
1166276965 19:41760839-41760861 CACACAGAAAATACAGCTAGGGG + Intronic
1167863742 19:52307109-52307131 CACACTGACCAGACAGTTATAGG + Intronic
925779783 2:7371447-7371469 CACAGTGCACAAACAGTAAGAGG + Intergenic
926147107 2:10403320-10403342 CACACTGTCCAAACACATATTGG + Intronic
928138772 2:28709517-28709539 CACAGGGAACAAAGAGATGGAGG + Intergenic
928190883 2:29166324-29166346 CACATTTTACAAACAGAAAGGGG - Intronic
929443822 2:41987523-41987545 CAAACAGAACACATAGATAGAGG - Intergenic
930575825 2:53147172-53147194 CACACTGGACAAACAAGGAGTGG + Intergenic
933576737 2:84077930-84077952 AACACTGAACAAATAAATAATGG - Intergenic
934962699 2:98691034-98691056 AACACAGAACATACAGAAAGAGG + Intronic
935635312 2:105245309-105245331 CAGTCTGAACAAACTGATATAGG - Intergenic
936332247 2:111557726-111557748 CACACTGGACACACAGATCTTGG - Intergenic
936727405 2:115336842-115336864 CACACTGAACAACGAGAAGGTGG - Intronic
937483236 2:122285960-122285982 CAGAGTGATCAAATAGATAGTGG - Intergenic
938650798 2:133381514-133381536 TACACTAAACAAACAGTTTGAGG - Intronic
939160113 2:138577594-138577616 CACACTGATGAAACAGAAAATGG - Intergenic
941526803 2:166616062-166616084 CACCCTGGGCAAACAGAAAGAGG - Intergenic
941969019 2:171329766-171329788 CACACTCATCAAACAAAAAGTGG + Intronic
942225206 2:173808823-173808845 CAGACAGAACAAAAAGAAAGGGG - Intergenic
943156175 2:184181141-184181163 GACAATGAACAAACAGATATAGG - Intergenic
943523011 2:188977509-188977531 CACACTGAACTAACAGGAAAAGG + Intronic
945446774 2:209947835-209947857 CAGATTGAAAAATCAGATAGAGG + Intronic
945672250 2:212816445-212816467 CAGCCTTAACAAACTGATAGAGG - Intergenic
947196335 2:227571962-227571984 AACAATGAATAAAAAGATAGGGG + Intergenic
948158347 2:235802612-235802634 GACACTGAACAAAATGATGGTGG + Intronic
948338963 2:237233772-237233794 CCCACTTGACAAACATATAGGGG - Intergenic
948645837 2:239403690-239403712 CACACTGATCATACACATATCGG - Intergenic
1170232371 20:14064172-14064194 CACAGTGAACAAATACTTAGAGG - Intronic
1170826364 20:19799551-19799573 CACAATGAACAACCACACAGAGG - Intergenic
1172897808 20:38312756-38312778 GACACTGAAAATACAGATGGGGG + Intronic
1174942788 20:54949196-54949218 CTCACTTAAAAGACAGATAGTGG + Intergenic
1175666191 20:60861946-60861968 ATCACTGAACAAAAAGCTAGTGG - Intergenic
1175678063 20:60964179-60964201 AACACTGTACAAACAGAGATGGG + Intergenic
1178368689 21:32009214-32009236 CACAATAAACAAAAAAATAGAGG + Intronic
1179556923 21:42184961-42184983 CACACTGAACAATCAGATTTGGG - Intergenic
1180592441 22:16952713-16952735 CACACACAATAAACAAATAGGGG - Intergenic
1180627142 22:17201316-17201338 CACACTGAACAAATTCATAAGGG - Intronic
1181434859 22:22904832-22904854 CACACTCAACCCACAGAGAGAGG - Intergenic
1181718128 22:24750321-24750343 CACAGTGAACACTCAGATTGAGG + Intronic
1182108994 22:27709645-27709667 CACAGTGAACAAACAGTATGTGG + Intergenic
949364683 3:3267977-3267999 AACACAAAACAAAAAGATAGGGG + Intergenic
953213867 3:40899626-40899648 CTCACTCAACAAACACATAGTGG + Intergenic
957099692 3:75811634-75811656 CACACTGACCACACAGAAACTGG + Intergenic
957972271 3:87397597-87397619 CACACTGAAAACACAAATAAAGG - Intergenic
959585313 3:108020242-108020264 CAGCCTGAACAAACACATGGGGG + Intergenic
963811578 3:149782066-149782088 AAAACTGAATAAAAAGATAGTGG + Intronic
964950209 3:162282064-162282086 CACACTGAATAGACAGAAACTGG - Intergenic
965197097 3:165614411-165614433 AACACTAAACTAACAGAGAGAGG + Intergenic
966809282 3:183828919-183828941 CTCACTGAAATAGCAGATAGTGG - Intergenic
967445892 3:189566105-189566127 AAAACTAAACAAAGAGATAGTGG + Intergenic
968360414 3:198143049-198143071 CACACTGGACAAGCAGAGACAGG + Intergenic
969588526 4:8108368-8108390 CAGACTGAACACACAGACAATGG + Intronic
969895709 4:10302594-10302616 CACACTGACCAGACAGTTATAGG + Intergenic
970243659 4:14035625-14035647 AACTCTGCATAAACAGATAGAGG - Intergenic
971689381 4:29813148-29813170 TACACTAAAAAAACAGACAGTGG + Intergenic
972041517 4:34606985-34607007 CACACGGAACAAAAAGGCAGAGG + Intergenic
972366831 4:38383733-38383755 CACAAGGAATTAACAGATAGTGG - Intergenic
974812225 4:66959267-66959289 CATACTGAACAAACATACTGTGG + Intergenic
981444265 4:144817569-144817591 AACAATGAATAAACAGATAAAGG + Intergenic
981579145 4:146235110-146235132 CACAGTGAACACACAGGAAGAGG - Intergenic
984310904 4:178056784-178056806 CACTGTAAACAATCAGATAGGGG - Intergenic
985838239 5:2286308-2286330 CACACTGGAAACACACATAGGGG - Intergenic
986965203 5:13261983-13262005 AACAGTGATCAAACAAATAGTGG - Intergenic
987689061 5:21243958-21243980 TAGATTGAACAAACAGATAATGG + Intergenic
988704544 5:33711503-33711525 CACACAGCACAAACAGATTTTGG + Intronic
989540413 5:42611436-42611458 CAGTATGAACAAAGAGATAGTGG - Intronic
992431870 5:76717520-76717542 CACCCTGAACAAAGACAGAGAGG - Intronic
993795032 5:92256380-92256402 CCCACTGAACGAACAGAAAGAGG + Intergenic
993877706 5:93327491-93327513 CACACAGAAAAAACAGACAAGGG + Intergenic
994152941 5:96470392-96470414 CACAATAAATAAACAGATAATGG + Intergenic
995113173 5:108450413-108450435 CTCACTGAAGAACAAGATAGTGG + Intergenic
997247329 5:132360893-132360915 CACACAGAACAAAAAGTCAGAGG - Intergenic
997886554 5:137635529-137635551 GACACTGAACAAAAAAATGGAGG - Intronic
1000211735 5:159113445-159113467 CACACTTTAAAAACAGTTAGAGG + Intergenic
1000945240 5:167414599-167414621 CAGACACAACAATCAGATAGAGG - Intronic
1002328724 5:178427256-178427278 CACACTGAACCACCAGATGCTGG + Intronic
1003405236 6:5822409-5822431 CCCAATGAAAAAACAGAGAGAGG + Intergenic
1006287115 6:33105051-33105073 CAAACTGGACAAACAGGAAGTGG + Intergenic
1006298953 6:33183267-33183289 CAAACTGGACAAACAGGAAGTGG + Intronic
1008851938 6:56032997-56033019 CAGACTGAAGAAACTGACAGGGG - Intergenic
1009954741 6:70439892-70439914 CATACTGAAAAAACAGCTGGGGG - Intronic
1011744379 6:90395659-90395681 AACATTGAAGAAAAAGATAGAGG - Intergenic
1013004148 6:106055619-106055641 AACACTCAACAAATAGATATTGG - Intergenic
1013208494 6:107965933-107965955 AACACTGACAAATCAGATAGGGG + Intergenic
1013287212 6:108691831-108691853 CAGGGTGAATAAACAGATAGGGG - Intergenic
1013816875 6:114109421-114109443 CCCACTGAACAGGCAGATGGAGG - Intronic
1014370321 6:120598539-120598561 CACACTGAAGAAACTGAAAAGGG - Intergenic
1014577547 6:123092137-123092159 AGCACTGAACAAACATATATTGG + Intergenic
1014667374 6:124255991-124256013 TCCACTGAACAAATAGATATGGG + Intronic
1018431756 6:163728519-163728541 CACACTGAAGAAAGAAAAAGAGG - Intergenic
1019259587 7:73584-73606 CACACTGGACAAGCAGAGACAGG - Intergenic
1022036013 7:26535324-26535346 CTCACTGAGGAAACACATAGAGG + Exonic
1023120297 7:36902325-36902347 CACACTGAAGAAACAGAGGCAGG - Intronic
1023677328 7:42643904-42643926 CACATTGAGCATACTGATAGAGG + Intergenic
1023796023 7:43792952-43792974 CACACTGTAAACACAGATAGTGG + Intronic
1025247003 7:57325091-57325113 GACAATGAAGAAACAGACAGAGG + Intergenic
1027608069 7:80325016-80325038 CACACTGAAAACACAGAAAAGGG + Intergenic
1029855571 7:103513010-103513032 CACAGTAAAAAAACAGATAATGG - Intronic
1030737572 7:113067828-113067850 CAAACTGAACAAAGAGAGACAGG + Intergenic
1031018139 7:116597646-116597668 GCCACTGAACAACCAGAAAGCGG + Intergenic
1031419532 7:121533680-121533702 CAAACTGAACAAAGAGAGACAGG - Intergenic
1036235335 8:7035012-7035034 CACAATGAACAAGCAGAATGTGG - Intergenic
1036394627 8:8358719-8358741 CACACTGAACAAAGAGACACAGG + Intronic
1036395106 8:8362733-8362755 CACACTGAACGAAGAGACACAGG + Intronic
1041671336 8:60494440-60494462 CACGCTGACCAAACAGAAAATGG - Intergenic
1043187740 8:77176389-77176411 CACATTGAGCAAACAGAGGGTGG - Intergenic
1045638871 8:104224255-104224277 CACAGTGGACAGACAGTTAGAGG + Intronic
1045963167 8:107992581-107992603 CACACTGTTCAAAGAGATAATGG + Intronic
1046595416 8:116255754-116255776 TAAACAGAACAAAAAGATAGAGG + Intergenic
1049012829 8:139898817-139898839 CACATTGAAAAAACAGAAACAGG + Intronic
1052134805 9:24896987-24897009 CACATTCAACAAACATATACTGG + Intergenic
1053873093 9:42514189-42514211 CACACTGTATAAACAGATATTGG - Intergenic
1053899660 9:42781731-42781753 CACACTGTATAAACAGATATCGG + Intergenic
1054261987 9:62875862-62875884 CACACTGTATAAACGGATATTGG - Intergenic
1054269237 9:62952563-62952585 CACACTGTATAAACAGATATTGG + Intergenic
1054845902 9:69797864-69797886 CACCCTGATTAAACAGATGGAGG + Intergenic
1062745113 9:138206879-138206901 CACACTGGACAAGCAGAGACAGG + Intergenic
1203686977 Un_GL000214v1:4291-4313 CACACTGACCATACAGAAACTGG - Intergenic
1203649298 Un_KI270751v1:99762-99784 CACACTGACCATACAGAAACTGG + Intergenic
1185557531 X:1033139-1033161 CTCACTGTACAAACACAAAGTGG + Intergenic
1186306603 X:8266447-8266469 CATACTGAGCAAACATATTGAGG - Intergenic
1187054558 X:15730450-15730472 CATACTTTACAAAGAGATAGAGG + Intronic
1188613962 X:32134382-32134404 AGAACTGAACAAACAGATAATGG + Intronic
1189337316 X:40177811-40177833 AACACTCAAAAAACAGCTAGAGG - Intergenic
1192776827 X:74254231-74254253 CACATTGAACACCCAGAGAGAGG - Intergenic
1192777744 X:74262684-74262706 GGCACTGAACAAACACACAGAGG + Intergenic
1194686370 X:96922810-96922832 GACACAGAAGAAACAGATATAGG - Intronic
1195060428 X:101189129-101189151 CACACTGACCAAACGGAAACTGG + Intergenic
1196664284 X:118300003-118300025 CACATTGACCAAACAGAAACTGG + Intergenic
1197450554 X:126609583-126609605 CAAGCTGAACAAACAGAGATTGG - Intergenic
1201496249 Y:14593765-14593787 CACAGTGAAAAAACACAAAGAGG - Intronic