ID: 1101958983

View in Genome Browser
Species Human (GRCh38)
Location 12:109233954-109233976
Sequence GGACACATTCAGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 214}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101958983_1101958989 8 Left 1101958983 12:109233954-109233976 CCATCCACATTCTGAATGTGTCC 0: 1
1: 0
2: 2
3: 19
4: 214
Right 1101958989 12:109233985-109234007 TGCAGACCACCTGGAGGATGAGG 0: 1
1: 0
2: 2
3: 34
4: 325
1101958983_1101958986 -1 Left 1101958983 12:109233954-109233976 CCATCCACATTCTGAATGTGTCC 0: 1
1: 0
2: 2
3: 19
4: 214
Right 1101958986 12:109233976-109233998 CATCCAGTGTGCAGACCACCTGG 0: 1
1: 0
2: 3
3: 7
4: 137
1101958983_1101958993 28 Left 1101958983 12:109233954-109233976 CCATCCACATTCTGAATGTGTCC 0: 1
1: 0
2: 2
3: 19
4: 214
Right 1101958993 12:109234005-109234027 AGGCACTGGTGCCGATTTTACGG 0: 1
1: 0
2: 1
3: 15
4: 154
1101958983_1101958988 2 Left 1101958983 12:109233954-109233976 CCATCCACATTCTGAATGTGTCC 0: 1
1: 0
2: 2
3: 19
4: 214
Right 1101958988 12:109233979-109234001 CCAGTGTGCAGACCACCTGGAGG 0: 1
1: 0
2: 2
3: 27
4: 195
1101958983_1101958991 14 Left 1101958983 12:109233954-109233976 CCATCCACATTCTGAATGTGTCC 0: 1
1: 0
2: 2
3: 19
4: 214
Right 1101958991 12:109233991-109234013 CCACCTGGAGGATGAGGCACTGG 0: 1
1: 0
2: 4
3: 31
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101958983 Original CRISPR GGACACATTCAGAATGTGGA TGG (reversed) Exonic
901020863 1:6254732-6254754 GGCCACATTTAGCATGTGGGTGG + Exonic
905351048 1:37346674-37346696 GGACCCACTGAGAAGGTGGAGGG + Intergenic
907119742 1:51998055-51998077 GGAAACATTCAACATGTGAATGG + Intergenic
908539939 1:65112620-65112642 GGAAGCATCCAGAATGAGGAGGG + Intergenic
913071429 1:115302532-115302554 GCACACATACAGAATGAGGGTGG + Intronic
915287217 1:154860703-154860725 GGACACCTGCAGACAGTGGAGGG + Intronic
918152951 1:181814298-181814320 GGCCCCATCCAGAATATGGAGGG + Intergenic
919758265 1:201079557-201079579 GGACACAGAAAGAAAGTGGAGGG - Intronic
919867232 1:201791700-201791722 GGAAACATTCAGAATCTTGGTGG - Intronic
920241984 1:204559298-204559320 GGTCACATACAAAATGTGAAAGG - Intergenic
920781351 1:208994413-208994435 GGACACATTTAAAGTGTAGAGGG + Intergenic
921134282 1:212246306-212246328 GCACACATTCTAAGTGTGGAAGG + Intergenic
922325593 1:224525476-224525498 GGACACACCCTGACTGTGGAAGG - Intronic
924389475 1:243537196-243537218 GGAAGCAGTGAGAATGTGGAAGG - Intronic
1063927744 10:10997125-10997147 TGACACATGCAGTACGTGGAAGG - Intergenic
1065853351 10:29809967-29809989 GGACACATTCACTGTGTGGGAGG - Intergenic
1068851566 10:61748480-61748502 GGACTAAATCAGTATGTGGAAGG - Intronic
1068881259 10:62051360-62051382 GAACACATTCAGAAAGAGGACGG - Intronic
1069045249 10:63736600-63736622 GGACCCAGTGAGAATGTGGATGG - Intergenic
1070105957 10:73431690-73431712 GGAGACATTAAGAGGGTGGATGG - Intronic
1071887718 10:89969094-89969116 GGGCAGCTCCAGAATGTGGATGG + Intergenic
1073877299 10:107939972-107939994 GGACACAATCAGGAGATGGAAGG + Intergenic
1073983140 10:109177664-109177686 GGCCAAATTCAGAGTGAGGAAGG - Intergenic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1075727187 10:124616671-124616693 GGCCACTTCCAGCATGTGGAGGG + Intronic
1075821275 10:125314252-125314274 AGAAAAATTCAGAAGGTGGATGG + Intergenic
1076323215 10:129599310-129599332 GGCCACATTCAAAACATGGAAGG + Intronic
1078357941 11:10646853-10646875 GGACACATTGAGGAAGGGGAAGG - Intronic
1081634064 11:44709100-44709122 GGAATTATTCAGACTGTGGAGGG + Intergenic
1082811150 11:57479789-57479811 GGGTACACTCAGAATGTGGGAGG - Intergenic
1083042657 11:59702571-59702593 GGACACTTTCACACTGTTGATGG - Intergenic
1083332459 11:61905326-61905348 GGCCACATGCAGAATGAGGGAGG + Intronic
1084434777 11:69132372-69132394 GGACAGAATCAGAATCTGGAGGG - Intergenic
1085330221 11:75642679-75642701 GGTCACCTTCTGAAAGTGGAAGG - Intronic
1087174063 11:95080080-95080102 GGACACGTTCAGTATATGGCAGG - Intergenic
1088266040 11:107988545-107988567 GGGGACTTTCAGAGTGTGGAGGG + Intergenic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1090448816 11:126788181-126788203 GGACAAATGCACAATCTGGAAGG + Intronic
1090655224 11:128838104-128838126 GGACACATTCGGAATGATGCAGG + Intronic
1091116160 11:133015689-133015711 GGCAACAGTCAGTATGTGGAAGG - Intronic
1091216266 11:133904222-133904244 GAACATTTTCAGATTGTGGACGG + Intergenic
1091748411 12:3007681-3007703 GGACACATTCATTATCTTGATGG - Intronic
1099258551 12:80346790-80346812 GGAGACATTTGGGATGTGGAAGG + Intronic
1100002422 12:89853504-89853526 GCACATATTGAGAATCTGGATGG - Intergenic
1100039783 12:90301378-90301400 GGAGACTTTGAGAAAGTGGAGGG - Intergenic
1100736099 12:97533688-97533710 AGACACATTCACTATGTGGTGGG - Intergenic
1101053005 12:100883599-100883621 GGACTCATTAAAAATGAGGAGGG - Intronic
1101305484 12:103523834-103523856 AAACAGATTCAGAATGTGTAGGG + Intergenic
1101362680 12:104042647-104042669 GGACAGCTTAAGAATGTGTAGGG + Intronic
1101698196 12:107146754-107146776 GGTCCCATTCACATTGTGGAGGG - Intergenic
1101958983 12:109233954-109233976 GGACACATTCAGAATGTGGATGG - Exonic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1107072886 13:36291008-36291030 GGATACATTCAGTCTGTTGAGGG - Intronic
1107209327 13:37834264-37834286 GGAAACAATTAGAATTTGGAAGG - Intronic
1111409341 13:87854035-87854057 GTTCCCATTCAGATTGTGGAAGG - Intergenic
1113050091 13:106201517-106201539 CGACACATTCAGAACGGGCATGG + Intergenic
1114812306 14:25915488-25915510 TGACACAATCAGAATGTGGTAGG - Intergenic
1115087767 14:29538136-29538158 GTACACAGTCAGATTATGGAAGG - Intergenic
1115131782 14:30062387-30062409 GGACACAGACAGAAAGTGAAGGG - Intronic
1117161239 14:52992589-52992611 GGACATATTTAAAGTGTGGAAGG - Intergenic
1118022866 14:61736919-61736941 GGACACATTCTGTTTGTTGAAGG - Exonic
1118264187 14:64278814-64278836 GGACCCATTCAGATGGTTGAGGG - Intronic
1124356036 15:28995361-28995383 CGACACTTTCAGACTGCGGAGGG - Intronic
1124366407 15:29074563-29074585 GAAGACATTCTGAAGGTGGATGG + Intronic
1124442547 15:29697676-29697698 GGAGAGTGTCAGAATGTGGAAGG + Intergenic
1126729068 15:51663256-51663278 GGACACATTCACATTGTGATGGG + Intergenic
1127667148 15:61158947-61158969 GTACACATTCATGATGTGGTAGG + Intronic
1128062900 15:64746562-64746584 GGACAGCTGCAGAGTGTGGATGG + Intronic
1128161340 15:65424580-65424602 GGCCACAGTGAGAAAGTGGAGGG - Intergenic
1130891967 15:88141073-88141095 GGACACATTACGAATGAGGTTGG + Intronic
1132790081 16:1681078-1681100 GGACAAATTCACAATGTGAGTGG - Intronic
1135197019 16:20403111-20403133 GCACACAGGGAGAATGTGGAGGG - Intronic
1135249008 16:20884405-20884427 GGATACATTCTGAAAGGGGAGGG - Intronic
1137957769 16:52850343-52850365 AGACTCATTCACAATTTGGAAGG + Intergenic
1138516922 16:57541279-57541301 GCTCACATTCAGCATGAGGAAGG + Intergenic
1141141418 16:81499186-81499208 GGACACGTTCACAGTGTGAATGG - Intronic
1141311015 16:82913309-82913331 CGGCTCATTCAGAATGTGCAGGG + Intronic
1143018943 17:3906478-3906500 AGAAACACTCAGAATGGGGATGG + Intronic
1150961198 17:69914337-69914359 AGACACTTTCAGAATCTGGGAGG - Intergenic
1151125619 17:71841632-71841654 GCACAGATACAGAATGTGCACGG + Intergenic
1156147863 18:34207986-34208008 TGACACCTGCAGAATGTGGAGGG - Intronic
1156226402 18:35113594-35113616 GAAAACATTTAAAATGTGGAAGG + Intronic
1156547488 18:37979290-37979312 GGAACCATTCAGAATGAGGAAGG + Intergenic
1158906693 18:62019972-62019994 GGAGACAGTCAGAATGTGCAGGG + Intergenic
1159122255 18:64184751-64184773 GGACACACTGAGAATGTGGCTGG - Intergenic
1162232600 19:9280171-9280193 GGACATATTTATTATGTGGATGG - Intergenic
1168674410 19:58266560-58266582 CGAAACATACAGAATGAGGAAGG + Intronic
925244539 2:2369354-2369376 GGACACGTTGATAATGGGGAGGG - Intergenic
926601099 2:14846250-14846272 TGACACATTCAAAATGCTGAAGG + Intergenic
927133707 2:20081399-20081421 GGACCCTTACAGAATGTGGGCGG + Intergenic
927662867 2:25007542-25007564 AGACAAATCCAGAATGTGGGAGG + Intergenic
930104372 2:47628495-47628517 GGATATGTTCAGAATGTGGCTGG - Intergenic
931438671 2:62271281-62271303 GGACATATTCAGATGGTTGAAGG - Intergenic
932326859 2:70868986-70869008 GGACACATTCAGATTATAGAAGG - Intergenic
933635970 2:84709267-84709289 GGGCACATGCAAAATGTGGTGGG - Intronic
935718477 2:105959612-105959634 GGGCATGTTCAGAATGTGAATGG + Intergenic
937614284 2:123902394-123902416 GGGTACATTCTGAATGTGTATGG + Intergenic
939245461 2:139617944-139617966 GTACACTTTCAGAAAGTGCAAGG + Intergenic
939660134 2:144878998-144879020 GGACACATGGGGACTGTGGATGG + Intergenic
939832499 2:147089415-147089437 AGACACACTCTCAATGTGGATGG - Intergenic
941269467 2:163407685-163407707 GGACACAGGCAGAATCTGTAAGG - Intergenic
941271325 2:163432591-163432613 GAACACATTCACAAAATGGAGGG - Intergenic
944735639 2:202560719-202560741 GGAAACATTTAGGATTTGGAAGG - Exonic
945477626 2:210304108-210304130 AGAAACATGCAGAATGTGCATGG - Intronic
945704352 2:213210638-213210660 GGACTCATGAAGAATGAGGATGG - Intergenic
946263418 2:218516666-218516688 GGACACATGCAGAATGTGCAAGG - Intronic
946487866 2:220118044-220118066 TGACAGATTCAGAGTGAGGAAGG - Intergenic
947038054 2:225882295-225882317 GGACACATTGAGAAGGAAGAAGG + Intergenic
947145043 2:227056654-227056676 GGACACATTCAGAACATAGCAGG - Intronic
1171241743 20:23574369-23574391 GGACACAGTCTGAAAGTGAAGGG - Intergenic
1171492319 20:25529881-25529903 GGTAAAATTCAGAATGTGAAAGG + Intronic
1172128260 20:32638382-32638404 GGTCACAGTCAGACTCTGGAGGG + Intergenic
1173789419 20:45818062-45818084 GGAGACCTTCAGAACCTGGAGGG - Intergenic
1174770345 20:53293575-53293597 GGACACTTTGAGAAGGGGGAAGG + Intronic
1175270780 20:57732426-57732448 AGAGATATTCAGCATGTGGATGG - Intergenic
1175297932 20:57922024-57922046 AGGCACCTTCAGGATGTGGAGGG - Intergenic
1175410866 20:58767932-58767954 GGAGACATTCAGAAAGTTGTTGG + Intergenic
1176270277 20:64232615-64232637 GGACTCCATCAGGATGTGGAAGG - Intronic
1177326510 21:19596792-19596814 GGACACATTTAGCATTAGGACGG - Intergenic
1177414130 21:20772350-20772372 AGACACATGCAGAATGTGCAGGG - Intergenic
1177606474 21:23385011-23385033 AGACGCATTCACAATGTGGGTGG - Intergenic
1179250993 21:39671238-39671260 GGACACATTCAAACTGTAGCAGG + Exonic
1180132775 21:45837184-45837206 GCAAACATTCAGAATGTTGGTGG - Intronic
1181333925 22:22115602-22115624 TGACGCATTCAGGATGTGGGGGG - Intergenic
1182848803 22:33453652-33453674 GGACACAGACAGAATGAAGATGG - Intronic
1183984550 22:41562284-41562306 GGAAACATTCAGAATTTGGAGGG - Intronic
1185151780 22:49167883-49167905 GAAGATATTCAGAATGTGTAGGG - Intergenic
950613429 3:14140407-14140429 GGACAGACTTAGAGTGTGGAGGG + Intronic
953757430 3:45658858-45658880 GGACATATTTAGAATCTGCATGG - Intronic
953855585 3:46497232-46497254 AGACACATGCAGTTTGTGGACGG + Intergenic
957461947 3:80533236-80533258 GGGCACATTCAATCTGTGGAGGG + Intergenic
958517767 3:95141494-95141516 GGACTCATACAGCATGTGCAGGG - Intergenic
959340151 3:105118538-105118560 GGAGACATTAAGAATGGGAAGGG - Intergenic
960308686 3:116093776-116093798 GGAAAGATTCAAGATGTGGATGG + Intronic
961189472 3:124945981-124946003 GGACACATTCAGGATATGGTGGG + Intronic
962149530 3:132878291-132878313 GGACACACTCAGAATGCAGAGGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963615881 3:147537556-147537578 GGACACAATCAGCAAGTGAAAGG + Intergenic
963672630 3:148271029-148271051 GGAAACAATCACAATGTGCATGG - Intergenic
964946595 3:162232873-162232895 GGACACATGTAGAATGTGTCTGG + Intergenic
968658841 4:1790512-1790534 GAAGCCATTCAGAATGTGGAGGG + Intergenic
969252629 4:5979480-5979502 ACACACATTCAGAAAGTGGGTGG + Intronic
970588757 4:17540374-17540396 GGAGACAAGCAGAGTGTGGAAGG + Intergenic
971385118 4:26135142-26135164 GGGCACATTGAGGATGTTGAGGG - Intergenic
971591238 4:28472228-28472250 AGACACCTTCACAAGGTGGAAGG - Intergenic
971862149 4:32121760-32121782 GGAAACATGCAGAATGGGGAAGG - Intergenic
976468127 4:85394862-85394884 GGACACATTCAAACTGTAAAAGG + Intergenic
977860808 4:101957598-101957620 GGAAATATTCAAAAAGTGGAAGG - Intronic
977917559 4:102611315-102611337 GGACACATACAGGCTGTGGGAGG - Intronic
978597319 4:110392317-110392339 GGAGACATTCTGAAGATGGAAGG + Intronic
980044325 4:127971451-127971473 GGACATATTCAGAGAGTGGCAGG - Intronic
980153556 4:129078905-129078927 GGAAACTTTCAGAATGCAGAAGG + Intronic
980214307 4:129832005-129832027 GGGCACATTCACAATCTGAAAGG - Intergenic
980269392 4:130564247-130564269 GGACACAGAAAGAAAGTGGAGGG + Intergenic
984560306 4:181260584-181260606 TGACACATTTGGAATGGGGAAGG - Intergenic
986729315 5:10623603-10623625 AGAAACATTCAGACTGTGGCAGG + Intronic
987273877 5:16341740-16341762 GGACACATTCAGCCTGTAGCAGG - Intergenic
988688452 5:33548474-33548496 GGACACACTCAAAATATGCAGGG + Intronic
989148662 5:38274935-38274957 TCAAACATTCAAAATGTGGAGGG + Intronic
991025150 5:62021080-62021102 AGACACAATCAGTATGTGGTAGG + Intergenic
991344847 5:65653404-65653426 GTAAAAATTCAGATTGTGGATGG - Intronic
992255693 5:74918606-74918628 GGACACAGTGAGAAGGTGGCAGG + Intergenic
992413555 5:76531612-76531634 GGACATATTCAGACTATAGAAGG + Intronic
992450169 5:76869204-76869226 GAACTCATTCAAAGTGTGGAGGG + Intronic
993180200 5:84542822-84542844 ACACACATTGAGGATGTGGATGG - Intergenic
993312115 5:86347439-86347461 GGAAACATTCAAAATGTGAAAGG + Intergenic
994897915 5:105729158-105729180 GGACACATTCAAACTGTAGTAGG - Intergenic
996066167 5:119081733-119081755 GGACAAATTGAGACTGTGCATGG + Intronic
997673248 5:135693805-135693827 GGCCTCATTCAGGTTGTGGACGG - Intergenic
998601405 5:143588982-143589004 GGGAACTTTCAGAATGTTGAAGG - Intergenic
999654434 5:153798412-153798434 TTACAGATTCAGCATGTGGAGGG + Intronic
1000052277 5:157574144-157574166 GAACACACAAAGAATGTGGAGGG + Intronic
1000418472 5:161009847-161009869 GGAGACATTAAGAATGGGAAAGG + Intergenic
1002811633 6:636756-636778 AGATGCATTCAGAATGAGGAAGG - Intronic
1003349923 6:5306630-5306652 GGACACACTGGGAATGTGAAGGG - Intronic
1005861550 6:29906389-29906411 GGACACTTGGAGAGTGTGGAGGG + Intergenic
1006049199 6:31327965-31327987 GGAGCCTTTCAGAAGGTGGAGGG + Intronic
1008311903 6:49986922-49986944 GGACTCATGGAGAATCTGGATGG + Intergenic
1009735720 6:67674142-67674164 GGATACATTCAAAAGGGGGATGG + Intergenic
1011071215 6:83386679-83386701 GGACACATTCAGTCTGTTGCAGG - Intronic
1012738959 6:102989411-102989433 GGACAGAATCAGAACATGGAAGG - Intergenic
1014786380 6:125624436-125624458 GGACACATTCACAATGATGTCGG - Intergenic
1015295035 6:131581422-131581444 GTAGACATTCAGGAGGTGGAAGG + Intronic
1018859837 6:167703696-167703718 GGACACATTTGGCCTGTGGAGGG + Intergenic
1020830395 7:13087909-13087931 GGACACATTCAAAGTGTAGAGGG - Intergenic
1021152342 7:17167018-17167040 GGACACATTCAAATTGTAGCAGG + Intergenic
1022558305 7:31323277-31323299 TGACACATTTAGAAAGTGAAGGG - Intergenic
1022987551 7:35673150-35673172 AGATACATTCAGAATGTGAGAGG - Intronic
1023071537 7:36439756-36439778 TGACACATGCAGACAGTGGAAGG + Intronic
1023547826 7:41337830-41337852 GGACACATTTAGAATGAGTTGGG - Intergenic
1028291442 7:89070341-89070363 GGACACACTCAGAATGAGCTGGG + Intronic
1032986368 7:137342426-137342448 GGACACATTCAGAAAATAGGAGG - Intronic
1033271932 7:139939802-139939824 GGAAACCAGCAGAATGTGGAAGG + Intronic
1033916749 7:146335760-146335782 GGAAACATTCAGATTGTGTGTGG - Intronic
1034310782 7:150085852-150085874 AGACACACTCAAAATGTGAAGGG + Intergenic
1034796062 7:154014779-154014801 AGACACACTCAAAATGTGAAGGG - Intronic
1037311774 8:17563683-17563705 GGTCAGATTCAGCATTTGGATGG + Exonic
1037468285 8:19182332-19182354 GGAGAAATTGAGAATGAGGAAGG - Intergenic
1037508080 8:19552639-19552661 GACGACATTCAAAATGTGGATGG + Intronic
1038177151 8:25191151-25191173 AGACACGTTCAGAATGGGGGGGG + Intronic
1038791725 8:30674014-30674036 GGACACAGTCTGAAGGTTGAGGG - Intergenic
1039130924 8:34263273-34263295 GGAAACTCTGAGAATGTGGATGG - Intergenic
1039458092 8:37721158-37721180 CTACACTTTCAGAATGGGGAGGG - Intergenic
1040522922 8:48193336-48193358 GGGCACATCCAGAAAGTGGGGGG - Intergenic
1041636487 8:60151940-60151962 GGACACAATAAGACTGGGGATGG - Intergenic
1041842425 8:62287778-62287800 GGTTAGAATCAGAATGTGGAAGG - Intronic
1044180611 8:89189240-89189262 GGTCACATTCATAAAGAGGAGGG + Intergenic
1045256483 8:100528304-100528326 GGAGACATTCAGTGTGAGGATGG - Intronic
1045902875 8:107306167-107306189 AGACACTAGCAGAATGTGGAAGG + Intronic
1046154078 8:110264301-110264323 GGACACATTAAGAAACTAGATGG + Intergenic
1047236716 8:123048272-123048294 GGACATATTTTGAAGGTGGAGGG - Intronic
1047869132 8:129062944-129062966 GGACAGATTTGGAATGTGGTTGG + Intergenic
1048114395 8:131505408-131505430 GGACAAAAGCAGATTGTGGAGGG - Intergenic
1048601855 8:135926892-135926914 TGACACATTCAAAATGTTAAAGG - Intergenic
1054724299 9:68634890-68634912 GGACAGATAGAGAACGTGGAGGG + Intergenic
1057402641 9:94738368-94738390 GGACATATTCAGAGAGTGGAAGG - Intronic
1060008863 9:120025743-120025765 GGACACATTTAGAATACAGATGG + Intergenic
1060849951 9:126866373-126866395 GGCCACAGTCAGAAGGTGGAGGG - Intronic
1061489224 9:130936010-130936032 GGACACAGCCAGCCTGTGGAAGG + Intronic
1185548920 X:968100-968122 GGACACATTCTGGAAATGGATGG - Intergenic
1187280635 X:17856249-17856271 AGACACATTCAGACTATGCATGG - Intronic
1188796471 X:34472262-34472284 GCACAACTTTAGAATGTGGAAGG + Intergenic
1188986870 X:36775801-36775823 GGAAACATCCAGAATAGGGAAGG - Intergenic
1190127563 X:47720325-47720347 GGACACATTTAGAAAGGGGCGGG + Intergenic
1190183747 X:48217323-48217345 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190193399 X:48296131-48296153 GGACAGAATCAGAGTGTGCAAGG - Intergenic
1190663628 X:52677732-52677754 GGACAGAATCAGAGTGTGCAGGG + Intronic
1190675795 X:52780690-52780712 GGACAGAATCAGAGTGTGCAGGG - Intronic
1190712246 X:53079276-53079298 TGACCCATACAGAATGGGGAGGG + Exonic
1192072588 X:67956878-67956900 GCACAGATTCAGAATATGTAGGG - Intergenic
1195265949 X:103179818-103179840 GGAAACATTCAGACTATGGAAGG + Intergenic
1195651408 X:107288956-107288978 GGAACCACTCAGAATGTGGGTGG - Intergenic
1196193426 X:112816939-112816961 GGAAACAATTAGTATGTGGATGG + Intronic
1197587634 X:128368880-128368902 TGACAGAGTCATAATGTGGAAGG - Intergenic
1197839585 X:130731043-130731065 GGATACATTCAGATGGTTGAAGG + Intronic
1202169308 Y:22024123-22024145 GGCCAGAATCAGAATATGGAAGG - Intergenic