ID: 1101967595

View in Genome Browser
Species Human (GRCh38)
Location 12:109291918-109291940
Sequence GCCGGAGGGGTGGCAGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 2, 1: 1, 2: 1, 3: 32, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101967595_1101967609 6 Left 1101967595 12:109291918-109291940 CCCCCGGCTGCCACCCCTCCGGC 0: 2
1: 1
2: 1
3: 32
4: 340
Right 1101967609 12:109291947-109291969 CCCTCCGGCTGCCACCCCTCCGG 0: 1
1: 2
2: 1
3: 27
4: 276
1101967595_1101967617 26 Left 1101967595 12:109291918-109291940 CCCCCGGCTGCCACCCCTCCGGC 0: 2
1: 1
2: 1
3: 32
4: 340
Right 1101967617 12:109291967-109291989 CGGCCTGCTCGTAACTCATCTGG 0: 1
1: 0
2: 0
3: 2
4: 19
1101967595_1101967602 -9 Left 1101967595 12:109291918-109291940 CCCCCGGCTGCCACCCCTCCGGC 0: 2
1: 1
2: 1
3: 32
4: 340
Right 1101967602 12:109291932-109291954 CCCTCCGGCCGCCACCCCTCCGG 0: 1
1: 1
2: 5
3: 25
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101967595 Original CRISPR GCCGGAGGGGTGGCAGCCGG GGG (reversed) Intronic