ID: 1101967603

View in Genome Browser
Species Human (GRCh38)
Location 12:109291933-109291955
Sequence GCCGGAGGGGTGGCGGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 2, 2: 5, 3: 45, 4: 488}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101967603_1101967619 28 Left 1101967603 12:109291933-109291955 CCTCCGGCCGCCACCCCTCCGGC 0: 1
1: 2
2: 5
3: 45
4: 488
Right 1101967619 12:109291984-109292006 ATCTGGCCAAGTGACAGCCACGG 0: 1
1: 0
2: 2
3: 16
4: 169
1101967603_1101967617 11 Left 1101967603 12:109291933-109291955 CCTCCGGCCGCCACCCCTCCGGC 0: 1
1: 2
2: 5
3: 45
4: 488
Right 1101967617 12:109291967-109291989 CGGCCTGCTCGTAACTCATCTGG 0: 1
1: 0
2: 0
3: 2
4: 19
1101967603_1101967609 -9 Left 1101967603 12:109291933-109291955 CCTCCGGCCGCCACCCCTCCGGC 0: 1
1: 2
2: 5
3: 45
4: 488
Right 1101967609 12:109291947-109291969 CCCTCCGGCTGCCACCCCTCCGG 0: 1
1: 2
2: 1
3: 27
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101967603 Original CRISPR GCCGGAGGGGTGGCGGCCGG AGG (reversed) Intronic