ID: 1101967610

View in Genome Browser
Species Human (GRCh38)
Location 12:109291948-109291970
Sequence GCCGGAGGGGTGGCAGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 2, 1: 1, 2: 1, 3: 32, 4: 340}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101967610_1101967623 25 Left 1101967610 12:109291948-109291970 CCTCCGGCTGCCACCCCTCCGGC 0: 2
1: 1
2: 1
3: 32
4: 340
Right 1101967623 12:109291996-109292018 GACAGCCACGGCCCCGGGCCTGG 0: 1
1: 0
2: 6
3: 52
4: 612
1101967610_1101967621 19 Left 1101967610 12:109291948-109291970 CCTCCGGCTGCCACCCCTCCGGC 0: 2
1: 1
2: 1
3: 32
4: 340
Right 1101967621 12:109291990-109292012 CCAAGTGACAGCCACGGCCCCGG 0: 1
1: 0
2: 4
3: 16
4: 184
1101967610_1101967622 20 Left 1101967610 12:109291948-109291970 CCTCCGGCTGCCACCCCTCCGGC 0: 2
1: 1
2: 1
3: 32
4: 340
Right 1101967622 12:109291991-109292013 CAAGTGACAGCCACGGCCCCGGG 0: 1
1: 0
2: 3
3: 103
4: 2686
1101967610_1101967617 -4 Left 1101967610 12:109291948-109291970 CCTCCGGCTGCCACCCCTCCGGC 0: 2
1: 1
2: 1
3: 32
4: 340
Right 1101967617 12:109291967-109291989 CGGCCTGCTCGTAACTCATCTGG 0: 1
1: 0
2: 0
3: 2
4: 19
1101967610_1101967624 26 Left 1101967610 12:109291948-109291970 CCTCCGGCTGCCACCCCTCCGGC 0: 2
1: 1
2: 1
3: 32
4: 340
Right 1101967624 12:109291997-109292019 ACAGCCACGGCCCCGGGCCTGGG 0: 1
1: 0
2: 1
3: 19
4: 348
1101967610_1101967619 13 Left 1101967610 12:109291948-109291970 CCTCCGGCTGCCACCCCTCCGGC 0: 2
1: 1
2: 1
3: 32
4: 340
Right 1101967619 12:109291984-109292006 ATCTGGCCAAGTGACAGCCACGG 0: 1
1: 0
2: 2
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101967610 Original CRISPR GCCGGAGGGGTGGCAGCCGG AGG (reversed) Intronic