ID: 1101970543

View in Genome Browser
Species Human (GRCh38)
Location 12:109309450-109309472
Sequence CTGTTGGCAAAGTTTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 250}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101970543_1101970546 13 Left 1101970543 12:109309450-109309472 CCCTCTTCAAACTTTGCCAACAG 0: 1
1: 0
2: 2
3: 19
4: 250
Right 1101970546 12:109309486-109309508 ATGCCCGAGAGCATGCGTTGAGG 0: 1
1: 0
2: 0
3: 12
4: 50
1101970543_1101970549 21 Left 1101970543 12:109309450-109309472 CCCTCTTCAAACTTTGCCAACAG 0: 1
1: 0
2: 2
3: 19
4: 250
Right 1101970549 12:109309494-109309516 GAGCATGCGTTGAGGAGCAGTGG 0: 1
1: 1
2: 0
3: 14
4: 183
1101970543_1101970550 22 Left 1101970543 12:109309450-109309472 CCCTCTTCAAACTTTGCCAACAG 0: 1
1: 0
2: 2
3: 19
4: 250
Right 1101970550 12:109309495-109309517 AGCATGCGTTGAGGAGCAGTGGG 0: 1
1: 1
2: 0
3: 0
4: 119
1101970543_1101970551 25 Left 1101970543 12:109309450-109309472 CCCTCTTCAAACTTTGCCAACAG 0: 1
1: 0
2: 2
3: 19
4: 250
Right 1101970551 12:109309498-109309520 ATGCGTTGAGGAGCAGTGGGAGG 0: 1
1: 0
2: 0
3: 17
4: 172
1101970543_1101970552 26 Left 1101970543 12:109309450-109309472 CCCTCTTCAAACTTTGCCAACAG 0: 1
1: 0
2: 2
3: 19
4: 250
Right 1101970552 12:109309499-109309521 TGCGTTGAGGAGCAGTGGGAGGG 0: 1
1: 1
2: 0
3: 17
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101970543 Original CRISPR CTGTTGGCAAAGTTTGAAGA GGG (reversed) Intergenic
900861977 1:5240348-5240370 CTGTTGGGAAAGACTGTAGAAGG + Intergenic
901951105 1:12747449-12747471 GAGTTGGCAAAGTTTCAAGTTGG + Intronic
904772758 1:32889705-32889727 CAGTTGGCAAAATTGGAATATGG - Intronic
905123476 1:35700829-35700851 CATATGGCAAAGTTTGAATATGG - Intergenic
907539866 1:55204968-55204990 CTGTTTGCACATTTTTAAGAAGG - Intronic
909971228 1:81992611-81992633 CTGCTGGATAAGTTTTAAGAGGG + Intergenic
910135749 1:83967298-83967320 CTGTTGGCATAGTTGGCAAAAGG - Intronic
911077591 1:93893188-93893210 CTTTGGGCAAAGTTTGAACTTGG - Intronic
911552423 1:99299656-99299678 CTTTTTGTAAAGTTTGAGGAGGG + Intronic
911751977 1:101505775-101505797 CTGTTGGATAAGGGTGAAGAAGG - Intergenic
912058257 1:105632176-105632198 CTTTTGGCTAAGTTGGAAAAGGG + Intergenic
913471001 1:119185982-119186004 TTGATGACAAAGATTGAAGAAGG - Intergenic
913792929 1:122561479-122561501 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913815286 1:122963004-122963026 CTGTTGGTAAAGTCTGAACGTGG + Intergenic
913845644 1:123506437-123506459 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913901847 1:124514464-124514486 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
913908941 1:124641580-124641602 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
914674132 1:149895213-149895235 CAATTGGCAAATTTTGAATAAGG + Intronic
917959593 1:180131831-180131853 CTCTTGTCAAGTTTTGAAGAGGG + Intergenic
920637234 1:207715518-207715540 CTGTTGGAAGAATTTCAAGAAGG + Intronic
921258413 1:213363432-213363454 ATGATGGCAGAGTTGGAAGATGG - Intergenic
921361631 1:214335180-214335202 CTATTGGGAAACTTTGGAGAAGG - Intronic
922019235 1:221686974-221686996 TAGTTGGCAAAATTTGAATATGG - Intergenic
1063129283 10:3163694-3163716 TTGTTGGAAAAGTTTGATGGTGG - Intronic
1065871743 10:29961513-29961535 ATGCTGGCAATGTTTGCAGAAGG + Intergenic
1066062162 10:31733796-31733818 CTGTGGGCAAATTTTGAGGGAGG - Intergenic
1068423960 10:56832105-56832127 CTTTTGGCAAAGTGGGAAGAGGG - Intergenic
1069021279 10:63491129-63491151 AAGTTGGCAAAGAATGAAGATGG + Intergenic
1069348188 10:67494822-67494844 CTGTTGTCAAACTTCAAAGATGG + Intronic
1069643783 10:69975967-69975989 CAATTGGCAACGTTTGAATATGG + Intergenic
1070003777 10:72402527-72402549 ATTTGGGCCAAGTTTGAAGACGG - Intronic
1070545861 10:77451974-77451996 CTATTAGCAAAGTTTGCAGGAGG - Intronic
1071017464 10:81014925-81014947 CTGTTGGAAAAATCTAAAGAAGG - Intergenic
1071492726 10:86146980-86147002 CTGTTGGTAAAATTGGAAGCAGG + Intronic
1072758355 10:98035998-98036020 CAGTTGGCAGAGGTTCAAGAGGG - Intergenic
1074290529 10:112135165-112135187 AAGTTGGCAAATGTTGAAGATGG + Intergenic
1074617961 10:115089300-115089322 ATGTTGGCAGAGTTTCCAGAGGG + Intergenic
1076169341 10:128306793-128306815 CTGTTGCCCAAGTGTGAAGTAGG + Intergenic
1079109062 11:17593916-17593938 CTGAGGTCACAGTTTGAAGAGGG - Intronic
1079186511 11:18242898-18242920 CTGTTAGAAAAGTTTGAGAAAGG - Intronic
1080892610 11:36422422-36422444 CTGTTGGGAAAGGTGAAAGATGG + Intronic
1081372237 11:42317952-42317974 CTGTTTGCAATGTGTCAAGAGGG - Intergenic
1081912649 11:46709927-46709949 CTGATGGAAAAGTTTCAACAAGG + Intergenic
1082655127 11:55845383-55845405 CTTTTGGCATAGTTTGAATTTGG + Intergenic
1082886075 11:58083863-58083885 CTAATGGCATAGTTTGAAGTTGG + Intronic
1083931416 11:65848124-65848146 CTTTTGGCACACTTTGGAGATGG - Intronic
1084683645 11:70681234-70681256 CTCTTGGCAAAGTCTGACGGCGG + Intronic
1085218641 11:74853790-74853812 CTGCTGGAAGAGTTTAAAGAAGG + Intronic
1087892357 11:103550029-103550051 CTGGTAGCAAAGTTTGATGGTGG + Intergenic
1088196842 11:107283569-107283591 CAGTTGGGAAAATTTGAACATGG - Intergenic
1089835824 11:121369758-121369780 CTGTGGGCAAAGTATGAAGGAGG + Intergenic
1090091652 11:123703361-123703383 CTGTTGGAACATTTTGAAAAGGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1094306185 12:29021876-29021898 CAATTGGCAAAGTTAGAATATGG + Intergenic
1094588625 12:31800583-31800605 CAATTGGCAAAATTTGAATATGG - Intergenic
1094879001 12:34692157-34692179 CTGTTTGTAAAGTCTGAAGGTGG + Intergenic
1097766087 12:63528537-63528559 CTGATGACAAAAATTGAAGAGGG - Intergenic
1100167544 12:91934054-91934076 CTGTTGTAAGAGTTAGAAGAAGG - Intergenic
1100270484 12:93020014-93020036 CTGTCGCCCAAGTGTGAAGAGGG + Intergenic
1101970543 12:109309450-109309472 CTGTTGGCAAAGTTTGAAGAGGG - Intergenic
1103632576 12:122274251-122274273 CTGGCGGCAAAGTGTGCAGAAGG + Intronic
1105326950 13:19379338-19379360 CTGATGAAATAGTTTGAAGATGG - Intergenic
1105864698 13:24449017-24449039 CTGATGAAACAGTTTGAAGATGG + Intronic
1105970332 13:25423931-25423953 GCGTGGGCAAAGTTTAAAGAGGG + Intronic
1106501470 13:30333242-30333264 CAATTGGGAAAGTTTGAACATGG + Intergenic
1107174565 13:37385337-37385359 CTGTGGGCAAATTGTGAAGGAGG - Intergenic
1108085044 13:46779067-46779089 CTCTTGGCAGAGTTTGTAAATGG + Intronic
1109254871 13:60067575-60067597 CTCCAGGCATAGTTTGAAGATGG - Intronic
1110198913 13:72825214-72825236 CAGTTGACAAAATTTGAAAATGG + Intronic
1112604128 13:100887528-100887550 TTTTTGGCAAAGTTTGACTATGG - Intergenic
1112916721 13:104560187-104560209 CTGTAGTTATAGTTTGAAGACGG + Intergenic
1113595206 13:111526745-111526767 CTTTTGGAACAGTGTGAAGAAGG - Intergenic
1114322815 14:21561163-21561185 CTCTTGTCACAGTTTGCAGATGG - Intergenic
1114440628 14:22743939-22743961 CAGTTGGCAAAATTTGAACAGGG + Intergenic
1115355730 14:32444712-32444734 CCTTTGGCAAATTATGAAGAAGG + Intronic
1115615679 14:35092364-35092386 CTGTTTCAAAAGTTTGAAGCAGG - Intronic
1115876393 14:37866511-37866533 ATTTTGGCAAAGAGTGAAGATGG + Intronic
1116543367 14:46129811-46129833 CTTTGGGTAATGTTTGAAGAAGG + Intergenic
1117205018 14:53433260-53433282 CTCTAGGCAAAATTTCAAGATGG + Intergenic
1121892021 14:97603271-97603293 CTGATTGCAAAGTTGGAAGTAGG - Intergenic
1124816189 15:32995842-32995864 CTGTTGCCATAGTTTTATGAAGG - Intronic
1124947995 15:34288387-34288409 CTCGTAGCAAAGTTTGAAGTCGG + Intronic
1125035230 15:35115966-35115988 CTGATGGCAAATTTTGAAATAGG + Intergenic
1126021689 15:44408414-44408436 CTGTTAGCAAAGTTTTAATATGG - Intronic
1126178790 15:45764883-45764905 CTGATGGAAAACTTAGAAGAGGG + Intergenic
1126919160 15:53501427-53501449 TTGTTAGCACAGTTTGAAGTTGG + Intergenic
1128252292 15:66171796-66171818 CTGTTGACAAAGGGTGAAGCGGG - Intronic
1130409559 15:83633412-83633434 CTGTAGGGAGTGTTTGAAGAAGG - Intergenic
1132482817 16:175083-175105 CTGTGGGCAGAGTCAGAAGAGGG + Intergenic
1135378183 16:21969111-21969133 ATGTTGGCAAAATTAAAAGATGG + Intronic
1136140964 16:28288446-28288468 CTATGGGAAAACTTTGAAGAGGG + Intergenic
1136607016 16:31342612-31342634 CTGGTGGTATAGTTTGAAGTCGG - Intergenic
1137385890 16:48042214-48042236 CTGTTGGCCAAATGTGAAGGAGG - Intergenic
1138813857 16:60181913-60181935 CTGTTGTTACAGTTAGAAGAAGG + Intergenic
1140650614 16:77084061-77084083 CTGAGGGCAAGGCTTGAAGAGGG + Intergenic
1143394453 17:6581084-6581106 TGGTTGGCAAAATTTGAATAAGG - Intronic
1143615295 17:8045964-8045986 CAGGTGCCAAAGTTTGAACATGG + Intronic
1143743776 17:8974624-8974646 CTATCGGCAAAATTTGAATAAGG + Intergenic
1143753534 17:9049760-9049782 CAGTTGGCAAGATTTGAATAAGG + Intronic
1146989495 17:37255419-37255441 CTTTTGGCATAGTGTCAAGAAGG + Intronic
1150545166 17:66149380-66149402 GTTTTTGAAAAGTTTGAAGAGGG + Intronic
1153668125 18:7384547-7384569 CGGAAGGCAAAGTTTGCAGAGGG - Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156514183 18:37666223-37666245 CTGTTGCTAAAGTTTGATGAGGG - Intergenic
1156530461 18:37810108-37810130 CTCTTGGCAAAATTGGAAAATGG + Intergenic
1157215602 18:45780747-45780769 CTCTTGGCAGAGTTTGCAGTTGG - Intergenic
1158176235 18:54659628-54659650 CAGTTGGGAAAATTTGAAGGTGG - Intergenic
1159375625 18:67588855-67588877 TTGGTGGGAAAGTTTGACGATGG - Intergenic
1162250193 19:9435820-9435842 GTGTTGGCAAAGTTAGAGGTGGG + Intergenic
1162887984 19:13710542-13710564 CTATTGGCAAATTATGAACAAGG + Intergenic
1163553650 19:17980605-17980627 CTCTTGGAAAAATTTGAAGCTGG + Intronic
1164204008 19:23042755-23042777 CTGTGGGCAAATTGTGAAGAAGG + Intergenic
1164344791 19:24905913-24905935 CTGTTGGAAAAGTCTGCAAACGG + Intergenic
1164378552 19:27711352-27711374 CTGTTGTTCAAGTGTGAAGAAGG + Intergenic
1166278152 19:41770012-41770034 CTGCTGGCAAAGTCTGAAGTCGG + Intronic
1166439570 19:42800477-42800499 CTGCAGGCAAAGTCTGAAGATGG - Intronic
1166457609 19:42956021-42956043 CTGCAGGCAAAGTCTGAAGATGG - Intronic
1166467934 19:43050458-43050480 CTGCAGGCAAAGTCTGAAGATGG - Intronic
1166474552 19:43111229-43111251 CTGCAGGCAAAGTCTGAAGATGG - Intronic
1166495201 19:43296799-43296821 CTGCAGGCAAAGTCTGAAGATGG - Intergenic
926840595 2:17075881-17075903 TTGTTGGGATAGTTTGAAGTTGG - Intergenic
928144321 2:28758283-28758305 CTGTTAGAAATGTTTGAAAATGG - Intronic
931044234 2:58332216-58332238 ATGGTGGCAATGTGTGAAGAAGG + Intergenic
931484383 2:62675560-62675582 TTTTTGGCAAAGTTAGAACATGG + Intronic
932823952 2:74923575-74923597 CTGGTGGCAAAGTTTCAAATGGG - Intergenic
935005386 2:99070148-99070170 ATGTTTACAAAGTTTGAACAAGG + Intronic
935447782 2:103175033-103175055 CTATAGGCAGAGTTGGAAGAGGG - Intergenic
935607187 2:104982972-104982994 CTGGTGGCCAAGTTTGAGGCAGG + Intergenic
936406742 2:112211408-112211430 CTGTAGGCAGAGTTCTAAGATGG - Intergenic
937074218 2:119089258-119089280 CTTTGGGGAAAGTTTGCAGAAGG - Intergenic
937902393 2:127030728-127030750 CTGTAGGAAAATTATGAAGATGG - Intergenic
938108678 2:128550183-128550205 CTTTTGGGAAAGGCTGAAGAGGG + Intergenic
938547611 2:132349036-132349058 ATGTTAACAAAGTTTGAAGCTGG - Intergenic
938826373 2:135009640-135009662 CTGTAGGAAAAGTTGGAAGCCGG + Intronic
938986151 2:136578555-136578577 CTGTTAACAGAATTTGAAGAAGG + Intergenic
941031706 2:160519158-160519180 CTGTGGGAAAAGTTGGGAGAGGG - Intergenic
941108056 2:161383811-161383833 ATGTTGGCAAAGGAGGAAGAAGG - Intronic
941122922 2:161552704-161552726 CTGTTGGCAATATTTCAAGAAGG + Intronic
941549364 2:166895572-166895594 CTGTTGGCAACGTTTGCAGCAGG + Intronic
942420545 2:175802564-175802586 ATGATGGCAAAGTGTGAAAACGG + Intergenic
943141547 2:183989114-183989136 CTGGTAGTATAGTTTGAAGATGG + Intergenic
943642971 2:190379207-190379229 CTGTTGTCACAGTCTGGAGATGG - Intergenic
946476785 2:220014182-220014204 CTGGTCGCAAAGTTGGATGAGGG + Intergenic
947792100 2:232874384-232874406 CCGTTGGTGAAGTTTGAACAGGG - Intronic
947873329 2:233451806-233451828 CTATTGGCAAAATTTGGACATGG + Intronic
948990593 2:241551954-241551976 CGGGTGGCAGAGTTTGAAGATGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170372092 20:15660365-15660387 CTGTTGAGAAAGTTTGGTGATGG + Intronic
1171052615 20:21874058-21874080 CTGTTGGCAATGGTTTCAGATGG + Intergenic
1172479320 20:35261627-35261649 CTGTTGGCTAAGATTGAGGCAGG - Intronic
1174643404 20:52064737-52064759 CAATTGGCAAAATTTGAATATGG + Intronic
1175480067 20:59304405-59304427 CTGGTGGAGAAGTTTGGAGAGGG - Intronic
1175729944 20:61347426-61347448 TTTTTGGTAAAGTATGAAGAGGG - Intronic
1181494193 22:23278773-23278795 CTGTTGGCAAAGTTTGCAAGGGG + Intronic
1182489604 22:30662458-30662480 CTTTTGCCAAAGTTTGGTGAGGG + Exonic
1183992042 22:41603742-41603764 GTATTGGCCAAGTTTGCAGAAGG - Intronic
949449603 3:4170947-4170969 AAGTTGAAAAAGTTTGAAGAAGG + Intronic
949506892 3:4737114-4737136 CTGTTGGCCAAATTAGAAGTTGG + Intronic
949674013 3:6432287-6432309 TTGGTGGCAGAGTGTGAAGAGGG - Intergenic
950539007 3:13598949-13598971 CAGTTGGCCAAGGTAGAAGAAGG + Intronic
952088441 3:29854361-29854383 CTGTTCTCAAATTTTGAAAAAGG + Intronic
953368023 3:42363885-42363907 CTGTTGGGAAAGGGTGATGATGG - Intergenic
955451271 3:59069522-59069544 TTGTTGGGAAGGTTGGAAGAGGG - Intergenic
958873273 3:99586734-99586756 CTGGTGGGAAAGCTAGAAGAGGG - Intergenic
959508054 3:107177140-107177162 CTGTTGCCATCTTTTGAAGAAGG + Intergenic
960396920 3:117148801-117148823 CAGTTGGCCAAGTTGAAAGAAGG + Intergenic
962364420 3:134768361-134768383 CTGTAGGCAAAGTCTGCAGCAGG - Intronic
962904086 3:139786337-139786359 CTGCTGGCATCTTTTGAAGATGG + Intergenic
963899607 3:150721439-150721461 CTGTTGTAATAGGTTGAAGATGG - Intergenic
965499781 3:169443601-169443623 CTGTTGGCAAAGTCAGAGAAGGG - Intronic
966057923 3:175718598-175718620 CTGTTGGAAAAACTCGAAGAAGG - Intronic
971336493 4:25728301-25728323 CTATTTGCAAAGTTTCCAGAAGG + Intergenic
971512096 4:27439221-27439243 CTGATGACAAAAATTGAAGAGGG - Intergenic
972056846 4:34814659-34814681 CTGATGGCACAGCTTCAAGATGG + Intergenic
973725544 4:53772066-53772088 CTGTTGCAAAAATGTGAAGAAGG + Intronic
973748854 4:53991796-53991818 GTGTTGGAAAAAGTTGAAGAGGG + Intronic
974056476 4:56988155-56988177 CTGGTGGCAGGGTTTGGAGAAGG + Intronic
978293442 4:107174369-107174391 CAGTTGGAAATGTTTGAAAAGGG + Intronic
979570304 4:122215582-122215604 CTGTTCACAAAGTTTGCAGTAGG - Intronic
980199003 4:129630064-129630086 CTCTTGGAAAAGTCTGAAAATGG + Intergenic
980613595 4:135189862-135189884 CTTTTGGCAAAGTTTAAACCAGG + Intergenic
980756300 4:137166956-137166978 CAATTGGTAAAATTTGAAGAAGG + Intergenic
981281997 4:142969188-142969210 CTGTAGGCAAATTGTGAGGAGGG + Intergenic
981806711 4:148724527-148724549 GTGTTGGCAAATTTTTAAAAAGG - Intergenic
983804810 4:171981485-171981507 CTGTTGGCAAATTATGAGGGAGG + Intronic
986692279 5:10323004-10323026 TTGTTGAAAAGGTTTGAAGATGG + Intergenic
987336418 5:16901464-16901486 CTTCTGGCAAAGTTTCCAGATGG - Intronic
988316222 5:29633024-29633046 CTGTTGTCAATGTCTGTAGATGG + Intergenic
988970690 5:36464953-36464975 CTATTGGGAATTTTTGAAGATGG + Intergenic
990491176 5:56304314-56304336 CTGGTAGCAATGTTTAAAGAGGG + Intergenic
990768216 5:59211864-59211886 CTATTGGGAAAGTGAGAAGAAGG - Intronic
990898107 5:60721293-60721315 CTGGTAGTAAAGTTTGAAGTTGG - Intergenic
992266122 5:75019943-75019965 CAGTTGGAAAATTTTGAAAATGG + Intergenic
993535962 5:89087016-89087038 CTGTGGGAAAAGTCTGAACATGG - Intergenic
993821533 5:92623462-92623484 CTGTTGAAATAATTTGAAGAAGG + Intergenic
995137767 5:108698585-108698607 ATGTTGCCAAAGGTAGAAGAAGG + Intergenic
995277550 5:110294349-110294371 CTCTGGGAAAAGTTTGTAGAGGG - Intronic
995697013 5:114890619-114890641 TTTTTGGAATAGTTTGAAGATGG + Intergenic
996659940 5:125989542-125989564 CTGTTGGCATTTTTTGGAGAAGG + Intergenic
998631684 5:143905542-143905564 CTATTGTAAAAGTTTGAAGTTGG + Intergenic
999787296 5:154903027-154903049 ATGTTGGGAAAGTATAAAGATGG + Intronic
1000451955 5:161400441-161400463 CTGTGGGCAAATTTTGTAGCGGG - Intronic
1000994730 5:167947064-167947086 CTGCTGGCCAAATTTGAAGGTGG + Intronic
1001084978 5:168693832-168693854 CTGAAGGCAAAATTTGGAGAGGG - Intronic
1003962983 6:11226233-11226255 TTGTTGGCAAAGTATAAACAGGG + Intronic
1005526389 6:26655248-26655270 CAATTGGCTAAGTTTGAATAAGG + Intronic
1005718379 6:28575643-28575665 CTGTTGGCATGGTTTACAGAGGG + Exonic
1008147345 6:47907753-47907775 CTGCTGGCAAAGGTTGAGCAGGG + Intronic
1008974386 6:57407896-57407918 CTGTTGGCAACGTTATGAGATGG + Intronic
1009163275 6:60309415-60309437 CTGTTGGCAATGTTATGAGATGG + Intergenic
1010920854 6:81678816-81678838 CTGATGGTACAGTTTGAAGTTGG - Intronic
1011155045 6:84321383-84321405 GTGTGGGGAAAGTTTGGAGAAGG - Intergenic
1011551897 6:88537728-88537750 CTGATGGTAAAATTTCAAGATGG + Intergenic
1011799242 6:90992279-90992301 CTTTTGGCAAAGTGTTAAAAGGG - Intergenic
1012477516 6:99630841-99630863 TTGTTGGCACAGTTGGAAGCTGG + Intergenic
1012752728 6:103184057-103184079 CTGTTCCCAAAGTCTGGAGAGGG - Intergenic
1014112398 6:117634009-117634031 CAGTTTGCAAAGTTTGATGTTGG + Intergenic
1014261374 6:119222112-119222134 CAGTTGGGGAAGTTTGAATATGG - Intronic
1015529076 6:134202910-134202932 TTGTTTGCAAATTTTGACGATGG + Intronic
1015758646 6:136633522-136633544 CTGTTGGCAAAGTCAGAACCAGG + Intronic
1015780066 6:136855807-136855829 CAGTTGGCAAAGTGGAAAGAGGG + Intronic
1016286550 6:142480333-142480355 CAGTTGGCCATGTTTGAATAAGG + Intergenic
1017038376 6:150287402-150287424 CTGTGGGCAAAATGTGATGAAGG + Intergenic
1017202300 6:151768504-151768526 CAATTGGCAAAATTTGAATAAGG + Intronic
1020175603 7:5879622-5879644 CTGTTGGCAAAGTGTGGAGAAGG - Intergenic
1021055952 7:16046436-16046458 CAGTTTTAAAAGTTTGAAGATGG + Intergenic
1024573534 7:50745952-50745974 CTTTTGGCAAATCTTGAACAAGG + Intronic
1027963088 7:84971766-84971788 CTCTTTGCTAAGTTTGAGGAGGG - Intergenic
1028079619 7:86558669-86558691 CTCTTGGTAAATTTTGAAGTGGG - Intergenic
1028090762 7:86697843-86697865 GTGTAGGAAATGTTTGAAGATGG + Intronic
1028836033 7:95376242-95376264 TAGCTGGCAAAGTGTGAAGAAGG + Intronic
1029083228 7:97991344-97991366 CTGTTGGCAAAGTGTGGAGAAGG + Intergenic
1030856786 7:114567894-114567916 CTGTTGGCAAGATATGATGATGG + Intronic
1032525744 7:132577208-132577230 CTGCTCGCAAAGTTTGCAGGGGG + Exonic
1033156688 7:138962876-138962898 CTGTGGGGGATGTTTGAAGATGG - Intronic
1033422192 7:141213606-141213628 TTATTGGTAAACTTTGAAGATGG + Intronic
1033970958 7:147038982-147039004 TTGTTGGAAGAGTGTGAAGAAGG - Intronic
1035489603 7:159261814-159261836 CTGTTGTCACTGTGTGAAGATGG + Intergenic
1036736264 8:11319906-11319928 CTGTTGGTGATGTATGAAGATGG + Intronic
1037233227 8:16685629-16685651 TTTTTGGCAAATTTTTAAGAGGG - Intergenic
1042439084 8:68804211-68804233 CAATTGCAAAAGTTTGAAGATGG - Intronic
1043072345 8:75654417-75654439 CCGATGGCAAAGTTTGAAGTTGG + Intergenic
1045182652 8:99802316-99802338 CTCTTGGCAAAGTGCCAAGAGGG + Intronic
1045267602 8:100633232-100633254 TTGTTGGTGAAGTTTGAATAAGG + Intronic
1045297046 8:100881127-100881149 CAATTGGCAAAATTTGAACAAGG + Intergenic
1045902265 8:107296557-107296579 CAGATGGCATAGTTTCAAGAGGG + Intronic
1049758057 8:144319529-144319551 CTGGTGGCCAAGGCTGAAGAGGG + Intronic
1049942365 9:559621-559643 CTGTTGACAATCTTTCAAGACGG + Intronic
1051339652 9:16099849-16099871 ATGTTGGCCAAATATGAAGATGG + Intergenic
1052623218 9:30941990-30942012 CTGATGGTATAGTTTGAAGCTGG - Intergenic
1053424574 9:38002713-38002735 CTGTTGGAAAAGCTTGAACTTGG - Intronic
1054259918 9:62853855-62853877 TAGGTGGCAAAGTTTGAACACGG - Intergenic
1054331850 9:63766153-63766175 TAGGTGGCAAAGTTTGAACACGG + Intergenic
1055138847 9:72852096-72852118 ATGTTGGCAAAATCTGAAGATGG - Intergenic
1055397016 9:75886920-75886942 CAGTTTGCAGAGTTTCAAGATGG + Intergenic
1055530854 9:77181941-77181963 CTCTTGGCAAATTTTGATGTTGG + Intronic
1059580631 9:115544364-115544386 TTGTTTGCAATGTTTGTAGAGGG - Intergenic
1061550465 9:131331556-131331578 CTGTGGGCAGGATTTGAAGAGGG + Intergenic
1202799232 9_KI270719v1_random:159277-159299 TAGGTGGCAAAGTTTGAACACGG + Intergenic
1186730483 X:12404269-12404291 CAATTGGGAAAGTTTGAATATGG - Intronic
1186990231 X:15059309-15059331 ATGTTGGCAAACTTTTAAGGAGG + Intergenic
1189799439 X:44678248-44678270 CAATTGGCAAAATTTGAATACGG - Intergenic
1190043703 X:47094322-47094344 CTGATGACAAAAATTGAAGAAGG - Intergenic
1192723100 X:73720984-73721006 CCTTTAGCAAAGTTTGAAGTTGG + Intergenic
1193358112 X:80546714-80546736 CTTTTGGTATAGTTTGAAGTCGG - Intergenic
1193431029 X:81405909-81405931 CTGTGTGCAAATTTTGAAGAAGG - Intergenic
1197250673 X:124213464-124213486 CAGTTGGCAAAGTTTTAATTGGG - Intronic
1197743339 X:129912963-129912985 CTCTTGGCAAAATTAGAAGTTGG + Intronic
1197988413 X:132291812-132291834 TTGTTGGATAAGTTTGAAGGTGG + Intergenic
1198502475 X:137265383-137265405 CCGTTGGTAAAATTTGAATATGG + Intergenic
1200977105 Y:9224741-9224763 ATGTTGGCAAACCTAGAAGAAGG + Intergenic
1202604863 Y:26630264-26630286 CTGATGAAATAGTTTGAAGATGG + Intergenic