ID: 1101976580

View in Genome Browser
Species Human (GRCh38)
Location 12:109364817-109364839
Sequence AATGCTACCTCCAGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101976576_1101976580 20 Left 1101976576 12:109364774-109364796 CCATATGATAATGTTACCTTTCA 0: 1
1: 0
2: 0
3: 32
4: 336
Right 1101976580 12:109364817-109364839 AATGCTACCTCCAGTGTGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 156
1101976579_1101976580 4 Left 1101976579 12:109364790-109364812 CCTTTCAAAGGGATAATCAAAAT 0: 1
1: 0
2: 2
3: 30
4: 308
Right 1101976580 12:109364817-109364839 AATGCTACCTCCAGTGTGTTTGG 0: 1
1: 0
2: 0
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101976580 Original CRISPR AATGCTACCTCCAGTGTGTT TGG Intronic
902151451 1:14446598-14446620 AATGGTACCTCGAGTGAGATAGG - Intergenic
902178232 1:14667686-14667708 AATGATACCTCCTGTGTGGAAGG + Intronic
904469414 1:30727079-30727101 AATGCTACATCAAGCGTATTGGG + Intergenic
908930540 1:69312281-69312303 ACTGCCACATCCAGTGTGTTGGG + Intergenic
909293942 1:73920798-73920820 AATTCTACCTCCTGTGTGGTGGG - Intergenic
910581943 1:88838110-88838132 AATATTACCTTCAGAGTGTTGGG + Intergenic
911384045 1:97152400-97152422 AATGATGCCTCCACTTTGTTAGG + Intronic
916279990 1:163039909-163039931 AATGCTACCTTCCTTGGGTTAGG + Intergenic
916861569 1:168811666-168811688 AATGTTCACTACAGTGTGTTGGG - Intergenic
917011061 1:170471605-170471627 CATGGTAACTCCAGTTTGTTTGG - Intergenic
917060564 1:171033057-171033079 ACTGCCACAGCCAGTGTGTTGGG + Intronic
918006609 1:180547229-180547251 ACTGTTACCTGCTGTGTGTTTGG + Intergenic
918802258 1:188986771-188986793 ACTGCCACAGCCAGTGTGTTGGG + Intergenic
921736411 1:218633572-218633594 ACTGCCACAGCCAGTGTGTTGGG + Intergenic
921865727 1:220086189-220086211 AACACTACCTTTAGTGTGTTCGG - Intronic
922812926 1:228428011-228428033 AATTCTACCTCCATTATCTTAGG - Intergenic
1064853683 10:19740145-19740167 AATACTAACTGCATTGTGTTTGG + Intronic
1067207672 10:44233602-44233624 ACTGCCACAGCCAGTGTGTTGGG + Intergenic
1071134575 10:82438333-82438355 ACTGCCACAGCCAGTGTGTTGGG + Intronic
1079151873 11:17907053-17907075 AAAGCTATTTCCAGTGTCTTGGG + Intronic
1079314312 11:19394902-19394924 AATGTAACCTGCAGTGTGTGTGG + Intronic
1080474333 11:32575644-32575666 AATGCAGCCTACAGTGTGTGTGG + Intergenic
1081419499 11:42856874-42856896 AATCCTACCTGCAGAGAGTTAGG - Intergenic
1081454938 11:43212343-43212365 ACTGCCACAGCCAGTGTGTTAGG + Intergenic
1082547466 11:54350595-54350617 AATTCTACCAAAAGTGTGTTTGG - Intergenic
1082548091 11:54358782-54358804 AATTCTACCAAAAGTGTGTTTGG - Intergenic
1082549108 11:54372088-54372110 AATTCTACCAAAAGTGTGTTTGG - Intergenic
1082550781 11:54394612-54394634 AATTCTACCAAAAGTGTGTTTGG - Intergenic
1082553750 11:54534084-54534106 AATTCTACCAAAAGTGTGTTTGG - Intergenic
1087808723 11:102586100-102586122 AATGCTGACTTCAGTGAGTTAGG + Intronic
1088567673 11:111189954-111189976 CTTGCTACCTAGAGTGTGTTAGG - Intergenic
1090527520 11:127553498-127553520 AATGCAAGCTGCAGTGTCTTTGG + Intergenic
1092443174 12:8527478-8527500 ACTGCCACAGCCAGTGTGTTGGG + Intergenic
1093230844 12:16540000-16540022 AATGGTGCTTCCAGTGGGTTAGG - Intronic
1095176856 12:39102421-39102443 AATGCTATCTCCATTCTGTTTGG - Intergenic
1096522616 12:52192746-52192768 CATGCTACCTCCTGTGAGGTGGG - Intergenic
1099172807 12:79385548-79385570 CATGCTACCACCAGTAAGTTTGG - Intronic
1100848653 12:98686158-98686180 AATGCTACATAAAGTTTGTTTGG - Intronic
1101976580 12:109364817-109364839 AATGCTACCTCCAGTGTGTTTGG + Intronic
1108165785 13:47691902-47691924 AATGCAACCCCCAGTGATTTGGG - Intergenic
1108722587 13:53147519-53147541 AATCCCACACCCAGTGTGTTCGG - Intergenic
1109239152 13:59862373-59862395 AAAGCTCCCTCCAGTGAGTGTGG + Intronic
1109814389 13:67561904-67561926 AATTCTACCTTCTGTGTGCTAGG + Intergenic
1111236050 13:85409531-85409553 AGTGCTGCCTCTAGTGTGCTTGG - Intergenic
1111589297 13:90323014-90323036 AGTGCTACCTCCAGGGTGAGAGG - Intergenic
1112651443 13:101403076-101403098 AAGGAGACCTACAGTGTGTTTGG - Intronic
1112854082 13:103744809-103744831 AATCCTCACTTCAGTGTGTTAGG - Intergenic
1113265687 13:108615335-108615357 AATTCTACTACCAGTGTATTAGG - Intronic
1113305327 13:109072048-109072070 AATGTTATCACCAGTGTGCTGGG + Intronic
1120417683 14:84240697-84240719 AATGCTGAATCCAGTTTGTTTGG + Intergenic
1120737146 14:88065859-88065881 GGTGCTAAGTCCAGTGTGTTTGG + Intergenic
1123736654 15:23191070-23191092 AATGCGACCTCCAGTGTTGGAGG + Intergenic
1124287879 15:28419747-28419769 AATGCGACCTCCAGTGTTGGAGG + Intergenic
1124295347 15:28497580-28497602 AATGCGACCTCCAGTGTTGGAGG - Intergenic
1126539887 15:49810265-49810287 AATCCAGGCTCCAGTGTGTTTGG + Intergenic
1126558516 15:50017772-50017794 AATGCTATTTCCAGAATGTTAGG - Intronic
1126831962 15:52616667-52616689 AATCCTAACTCCAGTGTCCTGGG - Intronic
1127687710 15:61364900-61364922 ACTGCCACAGCCAGTGTGTTGGG + Intergenic
1128710611 15:69868652-69868674 CATGCTACCTCCAAAGTGTAGGG + Intergenic
1129680643 15:77656710-77656732 GAAGCTGCCCCCAGTGTGTTAGG + Intronic
1130245352 15:82242904-82242926 AATGCTTCACCCAGTGTTTTAGG - Intronic
1130455334 15:84100450-84100472 AATGCTTCACCCAGTGTTTTAGG + Intergenic
1136236590 16:28917724-28917746 GATGCTCCCTTCACTGTGTTGGG + Intronic
1140144863 16:72296735-72296757 CATGCTATTTCTAGTGTGTTTGG - Intergenic
1149372475 17:56008842-56008864 AATTCTACCAACAGTGTCTTGGG - Intergenic
1152011480 17:77721478-77721500 AATGTTATGTACAGTGTGTTAGG - Intergenic
1153125332 18:1784411-1784433 ACTGCCACAGCCAGTGTGTTGGG - Intergenic
1157298489 18:46462622-46462644 CGTGCTCCCTCCAGTGTGGTGGG - Exonic
1158342532 18:56482105-56482127 AATTCTCCCTCAAATGTGTTTGG + Intergenic
1158893003 18:61890508-61890530 CATGCTGCATCCAGTGTGGTTGG - Intronic
1159134087 18:64316095-64316117 AATGCTAACTCCAGGTTATTTGG + Intergenic
1164860971 19:31561986-31562008 GTTGCTACCTGGAGTGTGTTAGG + Intergenic
1165571554 19:36779180-36779202 AATGTTACATGCAGTGTCTTTGG + Intergenic
926041778 2:9679490-9679512 CATGCTACAGCCAGGGTGTTGGG - Intergenic
927183842 2:20468040-20468062 AATGCTTCCTCCAATGTCTGGGG + Intergenic
928594975 2:32851319-32851341 AATGATTCCTCAAGTGTGCTTGG + Intergenic
930914313 2:56668597-56668619 AATGCTACTTCCACTGTTTTTGG + Intergenic
932826735 2:74948066-74948088 ACTACCACATCCAGTGTGTTGGG - Intergenic
933004215 2:76969821-76969843 AATGCTATCTCCATTTTCTTAGG + Intronic
939737833 2:145871635-145871657 AGAGCTCCCTTCAGTGTGTTTGG + Intergenic
944174882 2:196818245-196818267 CATGCTTCCTCCAGAGTGTGAGG + Intergenic
947944561 2:234090524-234090546 TATGCTACTTCCATTTTGTTTGG - Intergenic
1172727496 20:37057308-37057330 AATTCTACCAACAGTGTGTAAGG + Intronic
1173016909 20:39234200-39234222 AATGCTCCATCCAGTGAGTTAGG - Intergenic
1173085656 20:39913933-39913955 AATTCTACCTCCGGTGTATAGGG - Intergenic
1173411761 20:42817732-42817754 ACTGCCACAGCCAGTGTGTTGGG - Intronic
1178018634 21:28382274-28382296 AATCCTACCACCTGTGTGTTTGG + Intergenic
1182176539 22:28295468-28295490 AATCCTACCACAACTGTGTTTGG + Intronic
950270987 3:11614737-11614759 AATGCTGCTTCCACTGTGTCAGG - Intronic
954773864 3:52998938-52998960 AATGCTCCCTCCATGGTGGTCGG - Intronic
955852386 3:63234470-63234492 AATGCTGCCTTCATTGTTTTGGG + Intronic
959175003 3:102897078-102897100 AATGCCACCTCCTTTGTTTTTGG - Intergenic
960530758 3:118761701-118761723 AATGCCAGCTCCAGTCTGTAAGG - Intergenic
960591089 3:119366598-119366620 GATGCTACCTACTGTGTGGTAGG - Intronic
961454018 3:127015472-127015494 CAGGCTACCTCCAGAGTGGTAGG + Intronic
963642690 3:147878902-147878924 AATGCCATCTTCATTGTGTTTGG - Intergenic
966361596 3:179136386-179136408 AGTCCTACCTCCAGTATGGTAGG + Intergenic
970176635 4:13346185-13346207 AATGCAACCTCCAGTGTTGGAGG + Intergenic
970829014 4:20313477-20313499 AATGTGACCTCCAGTGTGGGAGG - Intronic
970908266 4:21242553-21242575 ATTGCCACCTCCAATGTGTTTGG + Intronic
971567839 4:28168168-28168190 AATACTACATCAAGGGTGTTGGG - Intergenic
971594158 4:28507467-28507489 ATTGCTATTTCCAGTGTCTTTGG - Intergenic
972794557 4:42402134-42402156 AATACTCCCTCCAGTGAGTGGGG - Exonic
974271469 4:59656296-59656318 ACTGCCACTTCCTGTGTGTTGGG - Intergenic
974760358 4:66266396-66266418 ACTGCCACAGCCAGTGTGTTGGG - Intergenic
976538209 4:86242630-86242652 ACTGCCACAGCCAGTGTGTTGGG + Intronic
977320022 4:95502158-95502180 CATGTTACTTCCAGTGTGATTGG + Intronic
978469441 4:109047145-109047167 AATGATACCCCCAGTGAGCTTGG - Intronic
979197833 4:117941583-117941605 ACTGCCACAGCCAGTGTGTTGGG + Intergenic
979646942 4:123080524-123080546 AATGCTAACACCAGTATTTTAGG - Intronic
980460525 4:133105207-133105229 AATTATATCTCCAGTGTGGTAGG - Intergenic
980496381 4:133590978-133591000 AGTGCTACCTTCTTTGTGTTTGG + Intergenic
982338724 4:154270788-154270810 ACTCCCACCTCCAGTGTTTTGGG - Intronic
985318055 4:188679342-188679364 TATGCTACCTCCATTGTTTTTGG + Intergenic
988321862 5:29708783-29708805 AATGCTATATTCAGTTTGTTTGG + Intergenic
990139084 5:52682469-52682491 ACTGCCACAGCCAGTGTGTTGGG + Intergenic
994332195 5:98519793-98519815 AATGCTACCTCCTGAAAGTTTGG - Intergenic
996893833 5:128456156-128456178 ACTGCCACAGCCAGTGTGTTGGG - Intronic
997792238 5:136771381-136771403 AATTCAAACACCAGTGTGTTTGG + Intergenic
1000021100 5:157320191-157320213 AATGCTACCTGCTGCCTGTTGGG + Intronic
1001839702 5:174864759-174864781 ACTGCCACAGCCAGTGTGTTGGG + Intergenic
1005789771 6:29286761-29286783 AATGCTACCTTCATTCTGTCTGG - Intergenic
1006242559 6:32698064-32698086 AATCCTTCCTCTAGGGTGTTGGG - Intergenic
1008306189 6:49903117-49903139 TATGATACCTCCAGTCTGGTGGG - Intergenic
1010183876 6:73120469-73120491 TATGCCACATGCAGTGTGTTTGG + Exonic
1010331284 6:74626666-74626688 ACTGCTACGGCCAGTGTATTAGG - Intergenic
1011453268 6:87518378-87518400 ACTGTTACCTCCACTGTGTATGG - Intronic
1012805330 6:103886067-103886089 GATTCTACCTCCAGTGGATTTGG - Intergenic
1015358192 6:132305226-132305248 ACTGCCACAGCCAGTGTGTTGGG - Intronic
1017635557 6:156439700-156439722 AAGGCTACCTTCAGTCTTTTGGG - Intergenic
1018561023 6:165100985-165101007 AATACTATCTTCATTGTGTTTGG + Intergenic
1023610773 7:41968140-41968162 AATGCTAGCTGCAGTGTGACTGG + Intronic
1028530291 7:91831195-91831217 AATTCTACCTACAGTGAATTAGG - Intronic
1031892259 7:127308676-127308698 AATGCTACCTCCTTTCTGTCCGG - Intergenic
1035109679 7:156470770-156470792 AATGCTATCTCCAGTGTTGGAGG + Intergenic
1035808606 8:2472881-2472903 AGTGCTTCTTCCAGTGTGTGTGG - Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1039685927 8:39801799-39801821 ACTGCCACAGCCAGTGTGTTGGG + Intronic
1042583079 8:70303927-70303949 AATTCTACTTATAGTGTGTTGGG - Intronic
1046507761 8:115158420-115158442 AATGTGACCTCCACTGTGTCCGG + Intergenic
1047175067 8:122532827-122532849 AATGCTACATCTAGTTTCTTTGG - Intergenic
1047669791 8:127133168-127133190 AATGCCACCAACAGTGTGTATGG - Intergenic
1048922831 8:139246475-139246497 AATCCTACCTCCAGTCCTTTAGG + Intergenic
1050479162 9:6072268-6072290 AATCCTAGCTCCAGTTTGTGGGG - Intergenic
1052083200 9:24232185-24232207 AATGATGACTCCAGTGTCTTTGG - Intergenic
1052225283 9:26077926-26077948 ACTGCCACAGCCAGTGTGTTGGG + Intergenic
1052825540 9:33171391-33171413 AATGCTTCCTCTAGTTTGTGAGG - Intergenic
1056875684 9:90327997-90328019 AATGCTATCTCATGTGGGTTTGG + Intergenic
1059128636 9:111720572-111720594 AATGCTAATTACAGTATGTTAGG + Intronic
1062026937 9:134344857-134344879 ATCACTACCACCAGTGTGTTGGG - Intronic
1185846279 X:3441002-3441024 ATTGCCACAGCCAGTGTGTTGGG + Intergenic
1186331197 X:8536021-8536043 AATGCTTCTTCCAGTCTTTTGGG + Intronic
1186430931 X:9503636-9503658 ACTGCCACAGCCAGTGTGTTGGG - Intronic
1189571881 X:42306825-42306847 ACTGCCACAGCCAGTGTGTTGGG - Intergenic
1190404093 X:50068752-50068774 AAGGCTTCCTCCAGACTGTTTGG - Intronic
1191008065 X:55731985-55732007 AGTGCTAACCACAGTGTGTTAGG + Intronic
1193549608 X:82874596-82874618 AATGCTGCCTTCATTGAGTTTGG - Intergenic
1196187188 X:112757052-112757074 AATTCTACCTACAGAGTGATAGG + Intergenic
1196237738 X:113302374-113302396 AATGTTACCTCCAATATTTTTGG - Intergenic
1196693304 X:118583541-118583563 ATAGCTGCTTCCAGTGTGTTGGG + Intronic
1198701217 X:139399774-139399796 ACTGATAAGTCCAGTGTGTTTGG - Intergenic
1198887072 X:141351301-141351323 AATGTCACCTCCAGTTTGTTTGG - Intergenic
1199665446 X:150093127-150093149 AATGCTAGCTGCTGTGTGGTTGG + Intergenic
1199849544 X:151715612-151715634 AAGGCTACCTCCCGTGTCTGGGG + Intergenic
1200818230 Y:7555402-7555424 ATTGCCACAGCCAGTGTGTTGGG - Intergenic
1201431414 Y:13906592-13906614 AATGCTCCTTCCAGTCTTTTGGG - Intergenic
1201790922 Y:17839847-17839869 AAAGCTACCTTCAGTGTTTTTGG + Intergenic
1201810632 Y:18066142-18066164 AAAGCTACCTTCAGTGTTTTTGG - Intergenic
1202352540 Y:24009496-24009518 AAAGCTACCTTCAGTGTTTTTGG + Intergenic
1202518239 Y:25660619-25660641 AAAGCTACCTTCAGTGTTTTTGG - Intergenic