ID: 1101981655

View in Genome Browser
Species Human (GRCh38)
Location 12:109412627-109412649
Sequence GATCCGCATGGTGGTTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 2, 2: 7, 3: 27, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101981655 Original CRISPR GATCCGCATGGTGGTTACAC AGG (reversed) Intronic
902281218 1:15375934-15375956 GTTCCGCATGGTGTTGACATTGG + Intronic
903410055 1:23134863-23134885 AATGCGCAGGTTGGTTACACAGG + Intronic
905752017 1:40473763-40473785 AATCCACGAGGTGGTTACACAGG - Intergenic
910035732 1:82785246-82785268 GATTGGAATGGTGGTTACATGGG + Intergenic
910969495 1:92841202-92841224 GAGCAGAATGGTGGTTACAGAGG - Intronic
911563928 1:99440105-99440127 GATCTGGGTGGTGGTTACATAGG + Intergenic
916172865 1:162014142-162014164 GAGCTGGTTGGTGGTTACACAGG + Intronic
916931656 1:169584897-169584919 GATTCACATGGTGAGTACACAGG - Intronic
918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG + Intergenic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
923165152 1:231354469-231354491 GATCCGGGTGGTAGTTACACAGG - Exonic
1063830806 10:9950492-9950514 GATGCGCAGGTTTGTTACACAGG + Intergenic
1064289636 10:14021703-14021725 AATCTGGGTGGTGGTTACACAGG + Intronic
1065270289 10:24024026-24024048 GGTCTGGGTGGTGGTTACACAGG + Intronic
1069306254 10:66974015-66974037 GATTTGTGTGGTGGTTACACTGG - Intronic
1069472043 10:68702216-68702238 GACCTGGATGGAGGTTACACAGG - Intergenic
1071934524 10:90513050-90513072 AATAGGGATGGTGGTTACACTGG + Intergenic
1073368217 10:102962278-102962300 GATGTGCAGGTTGGTTACACAGG - Intronic
1074384544 10:113006537-113006559 GATCTGGGTCGTGGTTACACAGG - Intronic
1075718310 10:124569884-124569906 GATCTGTGTGGGGGTTACACGGG - Intronic
1077649291 11:3955288-3955310 GATTGGGGTGGTGGTTACACAGG + Intronic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1082670573 11:56032051-56032073 GATACTGATGGTGGTTTCACTGG + Intergenic
1087915168 11:103801600-103801622 GGTCCTGATGGTGGTTACATGGG - Intergenic
1089440003 11:118507284-118507306 GATCCGAGTGGTGGCTACATAGG - Intronic
1094722444 12:33078175-33078197 GATGTGCATGTTTGTTACACAGG + Intergenic
1100517911 12:95345796-95345818 GATCTGGGTGGTGATTACACAGG + Intergenic
1100994232 12:100285133-100285155 GGTCCGGATGCTGGTTACATGGG - Intronic
1101980176 12:109399262-109399284 GATCTGGGTGGTGGTTACAGAGG - Intronic
1101981655 12:109412627-109412649 GATCCGCATGGTGGTTACACAGG - Intronic
1103317683 12:120069770-120069792 GATCTCCATGGTGGTTACACAGG - Intronic
1105790486 13:23793441-23793463 GATCTGGGTGGTGGTTCCACAGG + Intronic
1110574358 13:77038796-77038818 AATCAGGATGGTGGTTACCCAGG - Intergenic
1111069300 13:83142956-83142978 GATACGCAGGTTTGTTACACAGG + Intergenic
1111973190 13:94938599-94938621 GATCTGCATGATGGTTTCATAGG - Intergenic
1112472921 13:99705721-99705743 AATGCGAATGGTGGTTACCCGGG + Intronic
1114420552 14:22578731-22578753 GATCTGGATAGTGGTTAGACAGG + Intronic
1118583297 14:67326547-67326569 GATTGGCATGGTGGTTACACAGG - Intronic
1121088652 14:91166173-91166195 GATCTGGATGCTGGTTACATGGG + Intronic
1121761926 14:96453193-96453215 GATCCTCATGGTGGCTGTACTGG + Intronic
1124501598 15:30232258-30232280 GCTCAGAATGGTGGTTCCACGGG - Intergenic
1124741968 15:32306405-32306427 GCTCAGAATGGTGGTTCCACGGG + Intergenic
1125935189 15:43628890-43628912 GATCTGCATGGTGGTTACACCGG - Intronic
1125947947 15:43725202-43725224 GATCTGCATGGTGGTTACACCGG - Intergenic
1129222823 15:74142904-74142926 GATCTGGATGGTGGCTACATGGG + Intergenic
1129828959 15:78654798-78654820 GAGCTGGATGCTGGTTACACAGG - Intronic
1131018435 15:89077084-89077106 GAGCTGGGTGGTGGTTACACAGG - Intergenic
1133574942 16:7079738-7079760 GATCTAGGTGGTGGTTACACAGG + Intronic
1134249750 16:12566009-12566031 GCCCAGCATGGTGGTGACACAGG + Intronic
1137325797 16:47435139-47435161 GATGTGCATGTTTGTTACACAGG - Intronic
1139389608 16:66598512-66598534 GATTGGGGTGGTGGTTACACAGG - Intergenic
1139397698 16:66653525-66653547 GTTCAGCATGGTGGTTATAATGG + Intronic
1141161490 16:81632123-81632145 GATCCAGGTGGTGGTTACTCAGG - Intronic
1141558571 16:84852294-84852316 CATCTGGATGGTAGTTACACGGG - Intronic
1142276365 16:89120962-89120984 GCCCCCCAGGGTGGTTACACTGG + Intronic
1143844220 17:9760583-9760605 GATCTGCATGGTGGTTACATGGG + Intergenic
1145243775 17:21254340-21254362 GATTTGGATGGTGGTCACACGGG - Intergenic
1146175753 17:30665361-30665383 GGTCTGCATGGTGGATACATGGG - Intergenic
1146234674 17:31147161-31147183 GATCTGGATACTGGTTACACTGG - Intronic
1146349201 17:32081442-32081464 GGTCTGCATGGTGGATACACAGG - Intergenic
1152145917 17:78568794-78568816 TATCCACATGGTGCTTGCACGGG + Intronic
1152559138 17:81069148-81069170 GCTCCGAATGGTGGGTCCACGGG + Intronic
1152972000 18:170965-170987 GATGTGCATGCTTGTTACACAGG - Intronic
1153890938 18:9514472-9514494 GATCCTTGTAGTGGTTACACAGG - Intronic
1154378495 18:13828547-13828569 GTTCCCCATGGTGGTTACACGGG - Intergenic
1155481539 18:26293732-26293754 GATCGGCATGATGATTACACAGG - Intronic
1157885936 18:51366383-51366405 GATCTCAGTGGTGGTTACACAGG - Intergenic
1159064047 18:63549824-63549846 GAGCCACATGGTGGTCACTCAGG + Intergenic
1162983217 19:14252518-14252540 GGTCTGCATGGTGGATACACAGG + Intergenic
1164487370 19:28670304-28670326 GATCTGGGTGGTGGTTACATGGG + Intergenic
1165362712 19:35346537-35346559 AAACCGCATGGTGGTTAGCCTGG - Intronic
1166865587 19:45834678-45834700 GATCTGGGTGATGGTTACACTGG + Intronic
1167084725 19:47301382-47301404 GATCTGAGTGTTGGTTACACAGG - Intronic
1168178117 19:54640300-54640322 GATCTGCAGGTTTGTTACACAGG + Intronic
1168637383 19:58007101-58007123 GATCTGGGTGGTGGTTACACAGG + Exonic
927183378 2:20464717-20464739 GATCTGCAGGTTTGTTACACAGG - Intergenic
927612511 2:24556034-24556056 GATCTGCAGGTTTGTTACACAGG + Intronic
927811388 2:26182435-26182457 GATCCGCATGGAGGTGGCACTGG - Intronic
928145710 2:28773107-28773129 GATCTGGATGATGGTTACTCAGG + Intronic
930414177 2:51068877-51068899 TATCTGGTTGGTGGTTACACAGG - Intergenic
931468542 2:62514238-62514260 GATCTGGTTGCTGGTTACACAGG - Intergenic
932313198 2:70760699-70760721 GACCTGCATGGTGGTCACACGGG + Intronic
932711612 2:74069513-74069535 GATCCAGGTGGTGGTCACACAGG - Intronic
934876147 2:97922811-97922833 AATCTGGGTGGTGGTTACACAGG + Intronic
935320940 2:101888615-101888637 GATAGGCAAGGTGGTTACAAAGG + Intronic
935668183 2:105532252-105532274 GATCTGGGTGGTGGTTACAGAGG + Intergenic
942298030 2:174536160-174536182 GATCTACATGGTGATTACACAGG - Intergenic
947387234 2:229603675-229603697 GATCTGAGTGGTGGTTACACAGG + Intronic
1169468923 20:5866366-5866388 GATCAGGATGCTGGCTACACAGG - Intergenic
1169802690 20:9527100-9527122 GATCTGCATGCTGGTTGCAGAGG - Intronic
1170950856 20:20934611-20934633 GATCTGAATGGTGATTACATGGG + Intergenic
1172041444 20:32049392-32049414 GATTGGGGTGGTGGTTACACAGG + Intergenic
1172562425 20:35901031-35901053 GATCTGCATGGTGGTTATACAGG + Intronic
1172848190 20:37942704-37942726 GCTCTGGATGGTGGTTACACAGG + Intronic
1174726888 20:52871838-52871860 AATCTGCATAGTGGTTACCCAGG + Intergenic
1175038358 20:56021666-56021688 GATCCTCATGCTGGTTCCTCAGG + Intergenic
1175381587 20:58567744-58567766 GAGCCGCAGGGTGGCTACAGGGG - Intergenic
1176374985 21:6082634-6082656 GACACGCACGGCGGTTACACGGG - Intergenic
1176898770 21:14415779-14415801 GATCAGTGTGGTGGTTACACAGG + Intergenic
1178121455 21:29474145-29474167 CACCCCCATGGTGGTTACAGAGG + Intronic
1178685376 21:34706517-34706539 GATCTGCACGGTGGCTACACGGG - Intronic
1178749256 21:35284807-35284829 GATCTGGGTGGTGGTTACACGGG - Intronic
1179161007 21:38899176-38899198 GATTGGGATGATGGTTACACAGG + Intergenic
1179748490 21:43455611-43455633 GACACGCACGGCGGTTACACGGG + Intergenic
1181829556 22:25548955-25548977 GATCAGCATAGTGGTTACCTTGG - Intergenic
1182595837 22:31419645-31419667 GATTGGTTTGGTGGTTACACAGG + Intronic
1182808065 22:33092498-33092520 GATGTGCATGTTTGTTACACAGG + Intergenic
1183497969 22:38160949-38160971 GATTCGAGTGGTGGTTACACAGG + Intronic
1183563031 22:38591730-38591752 GATCCGAGTGCTGGTTACATGGG - Intronic
1184796210 22:46734557-46734579 GATCCGGGTGATGTTTACACAGG + Intronic
950634616 3:14306079-14306101 GATCCGGGTGGTGGCTCCACGGG + Intergenic
950651116 3:14407403-14407425 GATTTGGGTGGTGGTTACACAGG - Intronic
951597127 3:24330450-24330472 GATCTGAATGGTGGGTACATGGG - Intronic
952295699 3:32060026-32060048 GATCTGGTTGGTGGTTACACAGG + Intronic
952329676 3:32352749-32352771 GATTTGGATGCTGGTTACACAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952800265 3:37284229-37284251 GATGTGCAGGGTTGTTACACTGG + Intronic
953051277 3:39346305-39346327 GATCTGAGTAGTGGTTACACAGG + Intergenic
953111001 3:39938079-39938101 GATCTGTGTGCTGGTTACACAGG - Intronic
953758677 3:45669504-45669526 GATCTGGGTGGTGGTTACAGGGG - Intronic
955386197 3:58482611-58482633 TATCTGCATGTTGGTTACAAGGG + Intergenic
955402105 3:58599621-58599643 GATCTGAGTGGTGGTTACACAGG + Intronic
959882996 3:111467953-111467975 GATGTGCAGGGTTGTTACACAGG + Intronic
961035005 3:123636099-123636121 GATCCGGGTAGAGGTTACACAGG + Intronic
961537997 3:127581515-127581537 GATCCAGGTGGTGGGTACACAGG + Intronic
961860356 3:129912369-129912391 GATCTGGGTGGTGGTTACACAGG + Intergenic
962542710 3:136399298-136399320 GATGTGGGTGGTGGTTACACAGG - Intronic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
967672301 3:192251895-192251917 TATCTGGATAGTGGTTACACAGG + Intronic
969713264 4:8856579-8856601 GATGCGGGTGGTGGCTACACGGG + Intronic
971241715 4:24895260-24895282 GCTCTGGGTGGTGGTTACACAGG + Intronic
971248397 4:24950825-24950847 GTTCTGAATGGTGGCTACACAGG - Intronic
972578478 4:40373789-40373811 GACCCGGATGGTGGTTACGTAGG + Intergenic
973076195 4:45929230-45929252 GCTCTGCATGGAGGTGACACTGG + Intergenic
974568698 4:63613595-63613617 GATGCGCAGGTTTGTTACACAGG - Intergenic
974976489 4:68900172-68900194 GATGCGCATGTTTGTTACATAGG - Intergenic
985324410 4:188751871-188751893 CATCTGCATGGTAGTTACTCTGG + Intergenic
987255854 5:16150080-16150102 GATCTGGGTGGTGGTGACACAGG + Intronic
988537383 5:32081032-32081054 GATGCGCAGGTTTGTTACACAGG - Intronic
989129354 5:38090601-38090623 GATCAGGTTGATGGTTACACAGG + Intergenic
990178344 5:53132254-53132276 GATCTGTCTGGAGGTTACACAGG - Intergenic
990230397 5:53706797-53706819 GATGTGCATGTTTGTTACACAGG + Intergenic
990370284 5:55110787-55110809 AATCAACATGGTGGTTACAGTGG + Intergenic
990895271 5:60693046-60693068 GATCTGAATGTTGGTTACATGGG + Intronic
992188114 5:74263555-74263577 TATCCAAATGGTGGTTACAAAGG - Intergenic
993642704 5:90424928-90424950 GATCTGCATGGTGGTTACCTGGG + Intergenic
995404299 5:111776841-111776863 GATCTGAATGGTGTTTACAAAGG + Intronic
997047697 5:130339164-130339186 GATCTACATGGTAGTTACACTGG - Intergenic
998042496 5:138960961-138960983 GATCTGGGTGGTGGTTACATGGG + Intronic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
999509321 5:152231649-152231671 GATTGGGATGGTGGTTACATGGG - Intergenic
999949567 5:156634369-156634391 GATGTGCAGGTTGGTTACACAGG - Intronic
1000721796 5:164717403-164717425 GATCTGGATGCTAGTTACACTGG - Intergenic
1005435918 6:25812104-25812126 CATGCGTATGGTGCTTACACTGG + Intronic
1006745600 6:36339811-36339833 CATCTGGGTGGTGGTTACACAGG - Intergenic
1006791443 6:36703850-36703872 GACCTGGAGGGTGGTTACACAGG - Intronic
1006995695 6:38257876-38257898 GATCTGAGTGGTAGTTACACGGG + Intronic
1008778901 6:55077426-55077448 GATCTGCAGGTTTGTTACACAGG - Intergenic
1010046339 6:71448440-71448462 GATCTGAGTGTTGGTTACACAGG + Intergenic
1011239980 6:85261082-85261104 GATTCTCATGCTGGTTTCACAGG - Intergenic
1012330693 6:97982043-97982065 GAGCAGAATGGTGGTTACATGGG - Intergenic
1016755730 6:147684043-147684065 GATCTGGATGGTGGTGACATGGG - Intronic
1018240874 6:161773146-161773168 GATCCAGGTGGTGGTTACAGAGG + Intronic
1020811983 7:12859052-12859074 GATCTGTATGGTGGTTACATAGG - Intergenic
1022015911 7:26348098-26348120 GATCTGAGTGGTAGTTACACAGG - Intronic
1023032599 7:36103922-36103944 GATCCTCCTAGTGTTTACACTGG + Intergenic
1024336021 7:48205941-48205963 AATCATGATGGTGGTTACACAGG - Intronic
1026394017 7:69933039-69933061 GATCTGCACGTTGGTTACACTGG + Intronic
1029138900 7:98395541-98395563 GATCTGGGTGGTGGTTACACAGG + Intronic
1029827839 7:103219594-103219616 GATATGCATGTTTGTTACACAGG + Intergenic
1029908070 7:104112354-104112376 GATCTGAGTAGTGGTTACACTGG - Intergenic
1030032162 7:105379620-105379642 GATCTACATGGTCGTTACAGGGG + Intronic
1033409334 7:141102959-141102981 GATCCAGATGGTGGTTCCAGAGG - Intronic
1033803430 7:144927426-144927448 GATCTGGATAGTGGTTACATGGG - Intergenic
1037001279 8:13722424-13722446 GATGCGCAGGTTGGTTACATGGG + Intergenic
1039581350 8:38669331-38669353 GATGTGCATGTTTGTTACACAGG - Intergenic
1040617535 8:49053232-49053254 GATTGGAATGGTGGTTACACAGG + Intergenic
1043964432 8:86457045-86457067 GATTGTAATGGTGGTTACACAGG + Intronic
1050656181 9:7831248-7831270 GAAATGGATGGTGGTTACACAGG - Intronic
1051811891 9:21058418-21058440 GATATGCATGTTTGTTACACAGG - Intergenic
1053241910 9:36502750-36502772 GATCCAGATCATGGTTACACAGG - Intergenic
1053242588 9:36508188-36508210 GATCTGTGTGGTGGTTACATGGG + Intergenic
1054705671 9:68459286-68459308 GATCCAGATGGTAGTTACACGGG - Intronic
1054833435 9:69651325-69651347 GATCTGGGTGGTGGTTACACAGG + Intronic
1057531589 9:95851900-95851922 GCTCCAGATGGTGGTTACACAGG + Intergenic
1062011272 9:134268178-134268200 GATCTGCTTGGTGGGGACACTGG - Intergenic
1187428258 X:19198115-19198137 GATTGGTGTGGTGGTTACACTGG - Intergenic
1187491145 X:19752627-19752649 GGTCTGGGTGGTGGTTACACAGG + Intronic
1189235341 X:39482659-39482681 GATCTGGGTGGTGGTTACATGGG + Intergenic
1189302482 X:39962115-39962137 GATTTGAATGCTGGTTACACGGG - Intergenic
1189488638 X:41452271-41452293 GATTGGGGTGGTGGTTACACAGG + Intronic
1191590385 X:62876725-62876747 GATGTGCATGCTTGTTACACAGG - Intergenic
1192506762 X:71690451-71690473 GATCTGGATGGCGGTTACATGGG + Intergenic
1192513176 X:71738589-71738611 GATCTGGATGGCGGTTACATGGG - Intergenic
1192513521 X:71742924-71742946 GATCTGGATGGCGGTTACATGGG + Intergenic
1192519935 X:71791095-71791117 GATCTGGATGGCGGTTACATGGG - Intergenic
1192566107 X:72164837-72164859 GACCTGCATGGTAGTCACACTGG + Intergenic
1193251245 X:79292895-79292917 GATGCGCAGGTTTGTTACACAGG - Intergenic
1194430743 X:93801079-93801101 GATGGGGATGGTGGTTACATGGG - Intergenic
1194790762 X:98146662-98146684 GATGCGCAGGTTTGTTACACAGG + Intergenic
1195866846 X:109441662-109441684 GTGCTGCATGGTGGTTAAACAGG - Intronic
1197282294 X:124551337-124551359 CAACCGCATGGTGGTTACTTGGG + Intronic
1200388808 X:155921329-155921351 GATCTGGGTGGTGGTTACATGGG - Intronic