ID: 1101983471

View in Genome Browser
Species Human (GRCh38)
Location 12:109427512-109427534
Sequence GGGGCTGATGGAGCACCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101983464_1101983471 4 Left 1101983464 12:109427485-109427507 CCTCATAAGGCATCAGATCAAAT 0: 1
1: 1
2: 0
3: 13
4: 120
Right 1101983471 12:109427512-109427534 GGGGCTGATGGAGCACCTGCGGG 0: 1
1: 0
2: 2
3: 35
4: 380
1101983462_1101983471 26 Left 1101983462 12:109427463-109427485 CCAAAGGCAAATTTGATGACTTC 0: 1
1: 0
2: 0
3: 19
4: 228
Right 1101983471 12:109427512-109427534 GGGGCTGATGGAGCACCTGCGGG 0: 1
1: 0
2: 2
3: 35
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101983471 Original CRISPR GGGGCTGATGGAGCACCTGC GGG Exonic
900573751 1:3372912-3372934 GGGCCTGATGCAGAGCCTGCGGG + Intronic
900975095 1:6011810-6011832 TGGGCTGAAGGGGCACCTGTGGG + Intronic
901012832 1:6210869-6210891 GGAGCTGATGGAGAGGCTGCAGG + Exonic
901725861 1:11241566-11241588 GGAGCTGCTGGAGCCCATGCTGG - Exonic
903001864 1:20272076-20272098 GGGGCTGATGGAGCTGGTGCTGG + Intergenic
904050444 1:27635098-27635120 GCGGCTGCTGGAGCCCCGGCTGG - Exonic
904496216 1:30888297-30888319 GGGGCTGGAGGAGCACATGGAGG + Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
906325244 1:44841726-44841748 GGGGCTGGAGGGTCACCTGCTGG - Intronic
908128155 1:61050557-61050579 GGGGCTGGGGGTGCACCTGCAGG + Intronic
910192224 1:84605921-84605943 GGAGCTGATGGTGCAGCTGGAGG - Intergenic
913289954 1:117262817-117262839 GGGGCTGATGGTGGAGCTTCAGG - Intergenic
914195256 1:145445205-145445227 TGGGCTGATGGAGCACAGCCAGG - Intergenic
915247988 1:154569487-154569509 GCGGCTGGTGGAGCATCTCCTGG + Exonic
916720039 1:167477899-167477921 GGTGCTGATGGGGCAGTTGCTGG + Intronic
918955255 1:191199153-191199175 GGAGATGTTGGAGCTCCTGCAGG - Intergenic
919844409 1:201632315-201632337 GAGGCAGAAGGAGCAGCTGCTGG - Intronic
920185419 1:204156364-204156386 AAGGCTGATGGGGCACCTCCAGG + Intronic
920190439 1:204190469-204190491 GGGGCTGAGGGCGCAGGTGCGGG - Exonic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920433584 1:205934360-205934382 AGACCTGATGGAGCCCCTGCAGG - Intronic
920825494 1:209421118-209421140 GGGGCTGCTGAGGCACCGGCGGG - Intergenic
921180259 1:212626253-212626275 GTGGCTGAATGAGGACCTGCTGG - Exonic
922758557 1:228109841-228109863 GGGGCTGAGTGGGCACCAGCTGG + Intergenic
923281307 1:232445584-232445606 GGGCCTGCTGGAGCAGCTGTTGG + Exonic
1063716798 10:8535624-8535646 GGGGCTGAGGAACCACCTGTTGG - Intergenic
1065025490 10:21535450-21535472 GGGGCTGCTGCAGCGCCTGTGGG + Intronic
1066278076 10:33888096-33888118 GGGGCTGGAGGAGCACGTGGTGG + Intergenic
1069657785 10:70102907-70102929 AGGGCTGCAGCAGCACCTGCAGG + Intronic
1069738464 10:70672700-70672722 CGGGCTGTCGGAGCACCGGCTGG - Intergenic
1070290231 10:75109070-75109092 GGAGCTGGAGGAGCTCCTGCGGG - Exonic
1072404444 10:95136686-95136708 GGGGCTGACAGAGTACCTGGGGG + Intergenic
1072910432 10:99496298-99496320 GTGGCTGATGGAGTAAGTGCTGG + Intergenic
1074154088 10:110783157-110783179 GGAGCTGATGGAGCAAAGGCTGG + Intronic
1075123467 10:119681293-119681315 GGGACTGATGGAGCTCTTCCTGG - Intergenic
1075702135 10:124476593-124476615 TGGGCTGGGGGACCACCTGCAGG - Intronic
1075725960 10:124611024-124611046 GGTGCTGATGGAGCGGGTGCGGG + Intronic
1075745788 10:124726347-124726369 GGGACTGTTGGAGCTCCTGAAGG - Intronic
1076403856 10:130200022-130200044 GGGGCTCCTGGAGCACCGGAGGG + Intergenic
1076410269 10:130244359-130244381 GGTGCTCATGGAGCACTTTCAGG - Intergenic
1076495044 10:130891398-130891420 GGGGCTGTGGGGGCAGCTGCAGG - Intergenic
1076605562 10:131687101-131687123 GGAGGTGATGGAGCAGCAGCAGG - Intergenic
1076882721 10:133247471-133247493 GGTGCTGCTGGAGCAGGTGCAGG + Intergenic
1077049141 11:558925-558947 GGGGCTGCAGGTGCGCCTGCTGG + Exonic
1077069125 11:659849-659871 GGGGCTTCAGGAGAACCTGCTGG + Intronic
1078659421 11:13275245-13275267 GGGGTTGAAGGAGAACCTGTGGG - Intergenic
1079409204 11:20171350-20171372 GGGGAACATGGAGCACTTGCAGG - Intergenic
1080497030 11:32830142-32830164 GGGGCTGCTGGAACATGTGCGGG + Exonic
1080640752 11:34157085-34157107 GGGGCTGCTGGAAAACTTGCAGG + Intronic
1081789711 11:45774314-45774336 CGGCCTGATGGGGCACCTGGAGG - Intergenic
1082723156 11:56704479-56704501 AATGCTGCTGGAGCACCTGCAGG + Intergenic
1082873340 11:57963828-57963850 CTCTCTGATGGAGCACCTGCTGG + Intergenic
1083184972 11:61012322-61012344 GGGGCTGATGGACCAAGGGCCGG - Intronic
1083431221 11:62614432-62614454 GGTGCTGCTGGAGCACTTGCAGG + Exonic
1083644598 11:64165216-64165238 GGGGCTGAGGGAACAGCTCCGGG - Intronic
1083680911 11:64351511-64351533 GGGGCAGCTGCAGCACCTGGAGG + Exonic
1084188637 11:67488841-67488863 GGGGCAGAAGGAGGAGCTGCTGG + Intronic
1084598604 11:70131859-70131881 GGCCATGATGGAGCACCTCCTGG - Intronic
1084707547 11:70824077-70824099 GGCGTTGATGGAGCTCCTGAGGG + Intronic
1089100833 11:115961258-115961280 AGGGCTGATGGAGGAGATGCAGG - Intergenic
1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG + Intronic
1092001090 12:5032977-5032999 GTGGCTGGAGGAGCACTTGCTGG - Intergenic
1094056316 12:26272883-26272905 GGGGCTGATGGAGCCCAGCCAGG + Intronic
1094086806 12:26602237-26602259 AGGGGTGATGGGGCACCTGGTGG + Intronic
1097153365 12:56995407-56995429 TGGGCTGGTGGAGAACCTCCTGG + Exonic
1097229191 12:57498809-57498831 GGAGCTGAAGGAGCAGCTGAGGG + Intronic
1097260989 12:57720217-57720239 GGGGCTGGTGAAGGAGCTGCTGG + Exonic
1099609136 12:84844126-84844148 AGTGCTGATGGAGAAGCTGCAGG + Intergenic
1100388214 12:94123291-94123313 GGGGCTGAGTGAGCAGCAGCTGG + Intergenic
1101747938 12:107558369-107558391 GGGCATCCTGGAGCACCTGCAGG - Intronic
1101983471 12:109427512-109427534 GGGGCTGATGGAGCACCTGCGGG + Exonic
1102346365 12:112163626-112163648 GGGGATGATGGAGCCCAGGCCGG + Exonic
1102633501 12:114302314-114302336 GAGGCTGATGGATGACCGGCTGG - Intergenic
1102946893 12:116997697-116997719 AGGGCTGCTGGTGCTCCTGCAGG - Intronic
1103330599 12:120151295-120151317 GAGGCTTATGCAGCAGCTGCTGG - Exonic
1103703351 12:122859101-122859123 GGAGCTCATGGGGCAGCTGCAGG + Exonic
1103864048 12:124037350-124037372 GGGGGTGATGGGGCCCATGCTGG + Intronic
1104422843 12:128651360-128651382 GGTCCTGATGGTGCTCCTGCAGG + Intronic
1105767420 13:23575481-23575503 GGGGCTGAGGGAGCACCGTGAGG - Intronic
1105825631 13:24120074-24120096 GGGGCAGATGGATCAGGTGCAGG + Intronic
1110790476 13:79581882-79581904 GGAGTTGTTGGAGCTCCTGCAGG + Intergenic
1111436882 13:88222693-88222715 GAGGCTGGTGGATCACCTGAGGG + Intergenic
1112440240 13:99419805-99419827 GGGGCTGATGAAGCACCTGGAGG - Intergenic
1113617841 13:111693775-111693797 GGGGCTGTGGGAGGAGCTGCAGG + Intergenic
1113623374 13:111779036-111779058 GGGGCTGTGGGAGGAGCTGCAGG + Intergenic
1114626123 14:24131493-24131515 GGGGCTGATGGGGCCCCCCCTGG - Exonic
1114660169 14:24338783-24338805 GGGGCTGGTGGGGCAGCTGGTGG + Intronic
1115219584 14:31046186-31046208 GAGGCTGGTGGATCACCTGAGGG - Intronic
1116661609 14:47717321-47717343 GGCACTGATGGGGCACCTCCAGG - Intergenic
1117788085 14:59308579-59308601 GCAGATGATGGATCACCTGCTGG + Intronic
1118761692 14:68884203-68884225 GGGGGCCATGGAGGACCTGCAGG - Exonic
1119386565 14:74261036-74261058 AGGGGTGATGGAGGACCTGTGGG - Exonic
1119709716 14:76812866-76812888 CGAGCTGAGGGAGGACCTGCTGG - Exonic
1121421776 14:93821053-93821075 AGGGCTGATGGAGCTCCAGGAGG - Intergenic
1121433760 14:93905537-93905559 GGGGCTGCTGGAGCATCAGAGGG + Intergenic
1121583885 14:95049738-95049760 GGGGCAGATGGACCCTCTGCTGG - Intergenic
1121937928 14:98037437-98037459 GGGGCTGAGGGAGAACCTACGGG + Intergenic
1122023131 14:98855867-98855889 GGGGCTGCTGGAGCCCCAGCAGG + Intergenic
1122130783 14:99603764-99603786 GCGGCTGCAGCAGCACCTGCTGG - Exonic
1122601879 14:102925559-102925581 GGAGCTGATGGGGGACCTGTGGG + Intronic
1122858490 14:104571613-104571635 GGGGCTGCTGCAGCCTCTGCTGG - Intronic
1122879730 14:104685397-104685419 GGGGCTGCTGAAGCCCCAGCAGG + Intergenic
1123017265 14:105381348-105381370 GGGGATGTGGGGGCACCTGCTGG - Intronic
1125507033 15:40272943-40272965 GGTGCTCATGGAGTTCCTGCAGG + Exonic
1125723622 15:41857011-41857033 GAGCCTGAGGGAGCCCCTGCAGG - Exonic
1128649073 15:69397315-69397337 GAGGCTGGTGGAGAAGCTGCTGG + Intronic
1128684164 15:69671438-69671460 GGGGCTGAGGGAGCAAGGGCGGG - Intergenic
1129192600 15:73946340-73946362 GGGGCTGAGGGGGCCCATGCTGG + Intronic
1129455606 15:75674852-75674874 AGGACTGATGGAGCCCCTGGGGG - Exonic
1129661701 15:77556391-77556413 GGGGCTGATGGCACACAGGCTGG - Intergenic
1129752858 15:78077805-78077827 GGGGCTGAGGGGGCAACGGCCGG - Intronic
1129976061 15:79822863-79822885 GGGGAAGATGGAGCAGTTGCAGG - Intergenic
1132468449 16:88780-88802 GAGGATGACGGAGAACCTGCTGG - Exonic
1132544937 16:528552-528574 GGGGCTGCTGCGGCACCAGCTGG + Intronic
1132683197 16:1152275-1152297 CTGGCTGAAGGAGCAGCTGCTGG + Intergenic
1132727057 16:1343453-1343475 GGGGCTGCTGGAGGACATGCAGG + Exonic
1132732162 16:1367797-1367819 GGGGCTGGGGGAGAAGCTGCCGG + Intronic
1132887500 16:2189100-2189122 GGCGCTGCTGGAGCCCCGGCCGG - Exonic
1135424556 16:22325852-22325874 GCGGCGGAAGGAGCAGCTGCGGG + Exonic
1136429138 16:30186836-30186858 GGGCCTGATGCTGCCCCTGCGGG + Exonic
1136570391 16:31093384-31093406 CGGGCTGGTGGAGCATGTGCTGG - Exonic
1137603973 16:49775010-49775032 GGGGCTGGTGGGGCAGCTGCTGG - Intronic
1137987605 16:53123092-53123114 AGGGCAGATGGATCACCTGAGGG - Intronic
1138272695 16:55707347-55707369 GGGGGTGATGGAGAATCTGGTGG + Intergenic
1138585477 16:57967250-57967272 GGGGCTGAGGCAGCACCCTCTGG + Exonic
1139547538 16:67656685-67656707 GGGGCTGGAGGAGTTCCTGCTGG + Intronic
1139717975 16:68829085-68829107 GGGGTAGCTGGAGCAACTGCTGG + Intronic
1140477334 16:75245469-75245491 GAGGCTGAGGGAGCACAGGCAGG + Intronic
1141226494 16:82121127-82121149 GGGTCTGATGAAACCCCTGCAGG + Intergenic
1141694932 16:85614637-85614659 GGCGGTGGGGGAGCACCTGCCGG + Intronic
1142138761 16:88463300-88463322 GAGGCTGAGGGGGCAGCTGCAGG - Intronic
1142178550 16:88656225-88656247 GGGGCTCAGGCAGCGCCTGCCGG - Exonic
1142537228 17:627001-627023 GGGGCAGAGGGAGCAGCTGGTGG + Intronic
1143235294 17:5394329-5394351 GGGACTGAAGGAGAACCTGGAGG + Intronic
1143979852 17:10859435-10859457 GAGTCAGATGGATCACCTGCAGG + Intergenic
1144676912 17:17167783-17167805 GGGGCTGAGGGAGCGCATCCAGG + Intronic
1144768510 17:17746077-17746099 GGTGCTGGTGGAGGATCTGCTGG - Intronic
1144784680 17:17824961-17824983 GGGGGTGAGGGAACACCCGCGGG - Intronic
1146151483 17:30476996-30477018 GTGGATGATGGAGCACAGGCGGG + Intergenic
1146208088 17:30922041-30922063 GCGGCTGCTGGAGCTGCTGCGGG + Exonic
1147894933 17:43744299-43744321 GGGTCTGGTGGAGCCCCTGAGGG + Intergenic
1148027998 17:44601557-44601579 TGGGCAGAGGAAGCACCTGCAGG + Intergenic
1148774442 17:50087764-50087786 GGAGCTGGTGGAGGAGCTGCCGG + Exonic
1148863892 17:50618771-50618793 CGTGCTGATGAAGCACCTGGAGG + Exonic
1150248916 17:63695472-63695494 GGGGCTGATAGAGCCCCTGGGGG - Exonic
1151082644 17:71346367-71346389 GGGCCTGTTTGAGCAACTGCTGG - Intergenic
1152006997 17:77688576-77688598 GGGGCTGCTGGAGGATCGGCAGG - Intergenic
1152123857 17:78434860-78434882 GCGGCTGACGGAGCACCTCTGGG + Intronic
1152456894 17:80421914-80421936 GGAGCTGGTGCAGCAGCTGCGGG + Exonic
1152720779 17:81922967-81922989 GGAGCTGAACCAGCACCTGCGGG - Exonic
1152753539 17:82077566-82077588 GGGGCTGGGAGAGCCCCTGCTGG - Intergenic
1153906191 18:9663448-9663470 AGGGCTGAGGGTGGACCTGCTGG + Intergenic
1154210889 18:12377491-12377513 GGGGCTGATGGCGCACGTGGGGG + Intergenic
1155101593 18:22615826-22615848 GGGGGAGATGAAGCAGCTGCTGG - Intergenic
1156832907 18:41516457-41516479 GGGGAAGATGAAGCAGCTGCAGG - Intergenic
1157161659 18:45319122-45319144 GGGGCTCATGGAGAAACTGGAGG - Intronic
1157292458 18:46419716-46419738 GGGGCTGATGGAGCCCCTCGAGG + Intronic
1157504735 18:48218351-48218373 GGGGCAGAGGCAGCACCTCCTGG - Intronic
1157744299 18:50121188-50121210 GGGGCTGATGGTGCTACTGCAGG - Intronic
1157761625 18:50269561-50269583 GGGGAAGGTGGAGCAGCTGCAGG - Exonic
1158625597 18:59068921-59068943 GGAACTGAAGCAGCACCTGCTGG + Intergenic
1159883497 18:73882268-73882290 GGGGCTGCTGTATCCCCTGCAGG + Intergenic
1160043029 18:75362579-75362601 TGGGCTGCTGGAGGAGCTGCTGG + Intergenic
1160405970 18:78646699-78646721 GTGGCTGATGGGGGTCCTGCTGG - Intergenic
1160449085 18:78949666-78949688 GGGGATGTCGGAGCACCTGGTGG - Intergenic
1160512716 18:79461423-79461445 GGGTCTGCTGGAGCCACTGCGGG + Intronic
1160689733 19:456037-456059 GGGGCTGAGGGTCCTCCTGCGGG - Intronic
1160905971 19:1451884-1451906 GGGGATGAGGGGGCACCTGGGGG + Exonic
1161013376 19:1970703-1970725 GGTGCTGCCGGAGCTCCTGCGGG + Intronic
1161084801 19:2329943-2329965 GGGGCTGACAGAGCAGCTGGGGG - Intronic
1161435121 19:4258470-4258492 GGGGCAGAGGCAGCGCCTGCCGG - Intronic
1162534249 19:11253645-11253667 GGAGCTGCTGCAGCGCCTGCTGG + Exonic
1162966842 19:14160183-14160205 GAAGCTGATGGAGCAGCTGCTGG - Exonic
1163115098 19:15184514-15184536 GGGGCTCAGGAAGAACCTGCAGG + Intronic
1163234350 19:16022313-16022335 GGGGCGGCTGGAGCCCCTGGTGG + Intergenic
1163676128 19:18656170-18656192 GGGGTTGGTGGGGGACCTGCAGG + Intronic
1163872176 19:19831128-19831150 GGAGCTGTTGGAGTTCCTGCTGG - Intergenic
1163886114 19:19966286-19966308 GGAGCTGTTGGAGTTCCTGCTGG + Intergenic
1163958412 19:20665026-20665048 GGAGCTGTTGGAGTTCCTGCAGG + Intronic
1164810921 19:31155136-31155158 GGGGCTGATGGAGACAGTGCAGG - Intergenic
1165328000 19:35125330-35125352 GGGGCTCCTGGAGCCACTGCAGG - Exonic
1166392587 19:42417942-42417964 TTGGCTGATAGAGCACCAGCAGG + Intronic
1167219089 19:48185753-48185775 GAGGCAGATGGATCACCTGATGG + Intronic
1167455557 19:49595515-49595537 GGTGGTTATGGAGCAGCTGCCGG + Exonic
1168006036 19:53488252-53488274 GAGGTTGATGGATCACCTGAGGG - Intronic
1168306233 19:55437820-55437842 GGGTCTGATGGAGCAGGGGCTGG - Intronic
1168435109 19:56310348-56310370 GCGGCTGAGAGAGCAACTGCAGG + Intronic
925165073 2:1710878-1710900 GGTGCTGGTGGAGCAGGTGCTGG - Intronic
925221631 2:2146455-2146477 GCGGAGGATGGAGCATCTGCAGG + Intronic
925289975 2:2740870-2740892 GCTGATGAAGGAGCACCTGCTGG + Intergenic
925675307 2:6356070-6356092 GGGGCTGATTGAGGGCCTGGGGG + Intergenic
926716974 2:15932459-15932481 GGGGTACATGGAGCCCCTGCAGG + Intergenic
926886335 2:17602167-17602189 GTGGCCCATGGAGCACCTGCGGG + Intronic
927930488 2:27040518-27040540 GGGGCTGCTGGGGATCCTGCCGG - Intronic
929715073 2:44301830-44301852 GAGGCTGGTGGATCACCTGACGG + Intronic
931634304 2:64328034-64328056 GGGGAGGCTGGAGCGCCTGCTGG + Intergenic
932445990 2:71782007-71782029 AGGGCTAAGGGAGCACCTGTTGG - Intergenic
932490381 2:72116272-72116294 GGGGCTGAGGGTGCTCCTGGGGG - Intergenic
932714358 2:74090644-74090666 GGGGCTGGGGGAGGCCCTGCAGG - Intronic
933105228 2:78316257-78316279 GAGGCTGATGGTTCACCTGAGGG + Intergenic
934616391 2:95773912-95773934 AAGGCTGTTGGAGCATCTGCAGG + Intergenic
934644504 2:96050648-96050670 AAGGCTGTTGGAGCATCTGCAGG - Intergenic
934837920 2:97606738-97606760 AAGGCTGTTGGAGCATCTGCAGG - Intergenic
935595854 2:104876954-104876976 GGGGCAGATGGAGCAATTACAGG - Intergenic
936147009 2:109986879-109986901 GGCGCTGCTGGAGCACCACCTGG - Intergenic
936197683 2:110384604-110384626 GGCGCTGCTGGAGCACCACCTGG + Intergenic
936516302 2:113183474-113183496 GGGGCTCCTGCAGCACCTCCTGG + Exonic
937097113 2:119242534-119242556 GGGGCTGAAGGGGTGCCTGCAGG + Intronic
937155894 2:119718649-119718671 GGGGCTCAGGCAGCACCTGGGGG - Intergenic
937318259 2:120945688-120945710 GGGGCTGCTGGAGGCCATGCAGG - Intronic
937326311 2:120991511-120991533 GGGGCTGCTGGAGCCGCTGTGGG + Exonic
937466173 2:122134988-122135010 GGAGCTGCTGGAGGGCCTGCAGG + Intergenic
937591910 2:123624309-123624331 GGTGCTGATGGACCAATTGCAGG + Intergenic
938009920 2:127820747-127820769 GGGGCTGATGGTGCAGTTGGAGG - Intergenic
940808215 2:158211781-158211803 TGGGCAAATGGAGCACCAGCTGG - Intronic
941144363 2:161825290-161825312 GAAGATGATGGAGCATCTGCAGG - Intronic
942077224 2:172367103-172367125 GGGGCTGATGGTGCAGCAGTGGG + Intergenic
942565878 2:177264516-177264538 AGGGCCGAGGCAGCACCTGCTGG + Exonic
942877847 2:180823882-180823904 GGGGAAGATGGAGCAGCTGCAGG - Intergenic
944229185 2:197376207-197376229 GGTGCTGCTGGAGCACCTTGGGG - Intergenic
945060412 2:205903910-205903932 TGGGCTGTGGGAGCACCTGCTGG - Intergenic
946153945 2:217794647-217794669 GGGCCTCAAGGAGCACCTGAAGG - Intergenic
946162098 2:217841570-217841592 GAGGCAGATGGACCTCCTGCTGG + Intronic
946491291 2:220151757-220151779 GGGGCTGATGGAGCACAGCTGGG - Intergenic
946921264 2:224584688-224584710 GCGGCTGAAGGAGCAGCTCCCGG + Intronic
947178110 2:227387860-227387882 GTGGCAGATGCACCACCTGCAGG - Intergenic
947944884 2:234092884-234092906 GGGGCTGAGCGAGGAGCTGCAGG - Intergenic
948608966 2:239154989-239155011 CGGGCTGGTGGAGACCCTGCTGG - Intronic
949049826 2:241891533-241891555 GGGGCTGAGGGAGGAGCTGCCGG - Intergenic
1169416734 20:5423700-5423722 GTGGCTGCTGCAGCTCCTGCTGG + Intergenic
1170630383 20:18059475-18059497 GAGGCTGATGGGGCAGCTTCCGG + Intergenic
1171484817 20:25479029-25479051 GGGCCTGCAGGAGCAGCTGCAGG - Exonic
1172273460 20:33667347-33667369 AGGGCTGTGGGAGCGCCTGCTGG + Exonic
1172523354 20:35583175-35583197 TGGGAGGAGGGAGCACCTGCAGG - Intergenic
1172635384 20:36406551-36406573 AGGGGTGACGGAGCACCTGTGGG + Intronic
1173385325 20:42582227-42582249 GGGTGTGAAGGAGCTCCTGCAGG + Intronic
1175462270 20:59160429-59160451 GGGGATGAAGGAGCACCTCTGGG - Intergenic
1175542440 20:59756167-59756189 GGAGCTGGTGAAGCATCTGCAGG - Intronic
1175995797 20:62811857-62811879 AGGGGTGATGGAGAACCTGCAGG + Intronic
1176094311 20:63332976-63332998 GGGGCTGATGGGAGACGTGCAGG - Intronic
1176545486 21:8195952-8195974 GAGGCTGACGGATCACCTGATGG - Intergenic
1176564437 21:8378997-8379019 GAGGCTGACGGATCACCTGATGG - Intergenic
1177318387 21:19490755-19490777 GGAGCTGATAGAGCACATGAGGG + Intergenic
1180005344 21:45018338-45018360 GGGGCTGCTGGGGGTCCTGCCGG - Intergenic
1180081415 21:45489450-45489472 GGGGCTCCGTGAGCACCTGCTGG - Intronic
1180823558 22:18848045-18848067 GGGGCTGCTGCGGCAGCTGCAGG - Exonic
1181123987 22:20691144-20691166 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
1181189181 22:21126501-21126523 GGGGCTGCTGCGGCAGCTGCAGG + Exonic
1181210018 22:21283994-21284016 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
1181319151 22:21991393-21991415 GGGGCTGATGGAGCTGAAGCAGG - Intergenic
1181399501 22:22642950-22642972 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
1181649917 22:24253118-24253140 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
1181707462 22:24657628-24657650 GGGGCTGCTGTGGCAGCTGCAGG + Intergenic
1183425127 22:37735085-37735107 GGGCCTCTTGGAGCTCCTGCAGG + Exonic
1183616425 22:38948555-38948577 GGGGCTGAGGGTGCAGCTGAAGG + Intergenic
1184492919 22:44820554-44820576 GGGGCTGGTGGGACCCCTGCAGG - Intronic
1184679885 22:46064833-46064855 GGGGCTGATTGAGGGCCTGGTGG - Intronic
1184727937 22:46357194-46357216 CTGGCTGCTGGAGCATCTGCTGG + Exonic
1185011600 22:48317684-48317706 GGGCCTGATGGAGCACTTGGGGG - Intergenic
1203216929 22_KI270731v1_random:11439-11461 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
1203250356 22_KI270733v1_random:112189-112211 GAGGCTGACGGATCACCTGATGG - Intergenic
1203273703 22_KI270734v1_random:73951-73973 GGAGCTGCTGCAGCAGCTGCAGG - Intergenic
949930907 3:9077712-9077734 GGTGTGCATGGAGCACCTGCTGG + Intronic
950170322 3:10834671-10834693 GGGGCAGATGGAAGACATGCAGG + Intronic
950362428 3:12459099-12459121 GTGGCGAATGGAGCAACTGCTGG - Intergenic
950604274 3:14064559-14064581 GGGGCTGCTGGAGCTGCTACTGG - Exonic
950604282 3:14064613-14064635 GGGGCTGCTGGAGCTGCTACTGG - Exonic
951481857 3:23169686-23169708 GGGGCTGTGGGAGCACAGGCAGG + Intergenic
951697918 3:25465322-25465344 GGGGCCTATGGTGCATCTGCTGG - Intronic
952657855 3:35807904-35807926 TGGGCTCATAGTGCACCTGCTGG - Intergenic
953121721 3:40050075-40050097 AGTGCTGATGGAGGAGCTGCAGG + Intronic
953409018 3:42678643-42678665 GGTGCTGCTGGAGCTCCTGCTGG + Intergenic
953928324 3:46993553-46993575 GTGGGTGATGGGGCACTTGCTGG + Intronic
954176169 3:48847551-48847573 GGGGCTCACGGAGCTGCTGCAGG - Exonic
954715537 3:52524962-52524984 GGGGCTGCTGGAGCGCATGCAGG - Exonic
954863774 3:53711956-53711978 GGGCTTGATGCAGCACCTGAAGG + Intronic
955318287 3:57956862-57956884 GGAATGGATGGAGCACCTGCTGG + Intergenic
955952229 3:64253901-64253923 GGCGTTGATGGAGCTCCAGCAGG - Intronic
957311471 3:78525039-78525061 ATGGCTGTTGGAGCACTTGCTGG - Intergenic
958019760 3:87980979-87981001 GGGGCTGCTGCTGCACCTGGGGG + Intergenic
959778472 3:110199666-110199688 GGGAATGACGGAGCCCCTGCTGG - Intergenic
961123894 3:124398726-124398748 GTGGCTGATGGAGCTGCTGTGGG - Exonic
968832030 4:2937409-2937431 GGGGATGACGGAGCCCCCGCTGG - Intergenic
970225375 4:13851754-13851776 GGAGCTGATGCAGCTGCTGCTGG - Intergenic
973705447 4:53575991-53576013 GGGGAAGATGGAGGGCCTGCTGG - Intronic
974634709 4:64545863-64545885 GAGGCAGATGGATCACCTGGAGG + Intergenic
975577388 4:75876479-75876501 GGGGATGCTGGAGGACCTGCTGG + Exonic
978539763 4:109804192-109804214 GGTGCTAATGGAGGCCCTGCAGG + Intergenic
978839670 4:113196412-113196434 GGGGCTGGTGCAGGAGCTGCTGG + Exonic
983124409 4:163932674-163932696 GGGGCTGCAGGTCCACCTGCAGG + Intronic
984633868 4:182090356-182090378 TGGACTGATGGAGCAGCTGCTGG - Intergenic
985670834 5:1205837-1205859 GGGGCTGCAGGCTCACCTGCAGG - Intronic
985781214 5:1872761-1872783 GGGGCTGGACCAGCACCTGCAGG + Intergenic
987501899 5:18722199-18722221 AGGGTTGATGTAGCAGCTGCAGG - Intergenic
987708305 5:21482192-21482214 GGGGCTGCTGCTGCAGCTGCAGG + Intergenic
987708481 5:21483008-21483030 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
988751130 5:34191137-34191159 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
988751306 5:34191947-34191969 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
988751475 5:34192763-34192785 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
990218771 5:53563731-53563753 GGGGCGGGTGGATCACCTGTGGG - Intronic
991736270 5:69633061-69633083 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991736440 5:69633868-69633890 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991736790 5:69635506-69635528 GGGGCTGCTGCTGCAGCTGCAGG - Intergenic
991758623 5:69901275-69901297 GGGGCTGCTGTGGCAGCTGCAGG + Intergenic
991758796 5:69902082-69902104 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
991812766 5:70488700-70488722 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991812938 5:70489507-70489529 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991813115 5:70490335-70490357 GGGGCTGCTGCTGCAGCTGCAGG - Intergenic
991816072 5:70510806-70510828 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
991816246 5:70511616-70511638 GGGGCTGCTGCTGCAGCTGCAGG - Intergenic
991837852 5:70776341-70776363 GGGGCTGCTGTGGCAGCTGCAGG + Intergenic
991838025 5:70777148-70777170 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
994197204 5:96934973-96934995 GGGGCTTATGGGGCCCCTGGCGG + Intronic
994420376 5:99523206-99523228 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
994420544 5:99524025-99524047 GGGGCTGCTGCGGCAGCTGCAGG + Intergenic
994486496 5:100390289-100390311 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
994486833 5:100391927-100391949 GGGGCTGCTGCGGCAGCTGCAGG - Intergenic
994760944 5:103853235-103853257 GGTGCTGATGTAGAAGCTGCAGG - Intergenic
996002307 5:118379104-118379126 GGGGCTGAGGGAGCTGCTGCTGG - Intergenic
996015686 5:118531708-118531730 GAGTCTGATGGAGCACTTACTGG - Intergenic
1000006115 5:157186441-157186463 GGGGCAGGTGGATCACCTGAGGG + Intronic
1000253727 5:159518792-159518814 GGAGGTGATAGGGCACCTGCGGG + Intergenic
1001216809 5:169864111-169864133 GGAGCTGATGTAGCCGCTGCTGG - Intronic
1001256185 5:170185133-170185155 GGGGCTCTTGGAGCACCACCTGG + Intergenic
1002132775 5:177091678-177091700 AGTGCTGATGGCGCAGCTGCAGG - Exonic
1004128977 6:12901153-12901175 TGGGCTGATGGAGGCCCTGTTGG + Intronic
1004806060 6:19205139-19205161 GGGGTTGAGGGAGCTCCTCCTGG + Intergenic
1005582482 6:27247988-27248010 GGGGTGGCTGGAGCAACTGCTGG + Exonic
1007497300 6:42268966-42268988 GAGGCTGCTGGGGCACCTGCTGG + Exonic
1007630572 6:43270918-43270940 GGGGCTGACCGAGCACCTACAGG - Intronic
1010752601 6:79631627-79631649 GAGTGTGATGGATCACCTGCCGG - Intronic
1013314549 6:108929104-108929126 GGGGCTGAAGAACCACCTGTTGG - Intronic
1014258622 6:119189735-119189757 GGGGCTGATGCAGCTCCCGAAGG - Exonic
1017949896 6:159127881-159127903 GGGTCTGAGGGAGCCCCTTCCGG + Intergenic
1018626096 6:165780500-165780522 GGGTCTAATGGAGCATCTGTTGG - Intronic
1018906616 6:168079529-168079551 GGGGAAGATGGAGCAGCAGCAGG + Intronic
1018992448 6:168684574-168684596 TGGGCTGGTGCCGCACCTGCTGG + Intergenic
1019048812 6:169167882-169167904 GGGGCTGTTGGAGAACCCCCAGG + Intergenic
1019339712 7:503264-503286 GGCACAGATGGAGCGCCTGCTGG - Intronic
1019538293 7:1540009-1540031 GGAGCTGAACCAGCACCTGCGGG + Exonic
1021037159 7:15814157-15814179 AGTGCTGATGGAGAAGCTGCAGG + Intergenic
1021562010 7:21977715-21977737 GGTGGTGTTGGAGCAGCTGCTGG - Intergenic
1022383451 7:29881997-29882019 GGGGCTGATGGTGTAAGTGCAGG - Intronic
1026592938 7:71712242-71712264 GGGGCCCATCGAGCACCTGCCGG - Exonic
1026952434 7:74356550-74356572 GGAGCTGATGGAGGAACTGCTGG - Exonic
1029356148 7:100053347-100053369 GGGAGTCATGCAGCACCTGCTGG - Intronic
1030216093 7:107044928-107044950 GGGACTGACGGAGCTGCTGCAGG + Exonic
1031037940 7:116808538-116808560 GGGGCTGGTGTAGAAGCTGCAGG + Intergenic
1033195503 7:139323914-139323936 GGGGCTAATGGATCACTTGGAGG - Intergenic
1033597082 7:142865953-142865975 GGAGCCGATGGAGGACCTGGGGG - Exonic
1033641713 7:143268162-143268184 GGAGCTGCTGGCGCACCTGCTGG + Exonic
1033998339 7:147381107-147381129 AGAGCTGATTGAGCAGCTGCTGG + Intronic
1034457302 7:151177708-151177730 GAGGCTGATGGACTGCCTGCAGG + Intronic
1035115275 7:156518608-156518630 GGTGGGGATGGAGCACGTGCGGG - Intergenic
1035247392 7:157572695-157572717 GGAGCTGAAGGAGCAGTTGCAGG + Intronic
1035444844 7:158933174-158933196 GTGGCAGATGGAGCAACTGTGGG + Intronic
1035759149 8:2056392-2056414 GAGGCTGAAAGAGCTCCTGCAGG + Intronic
1035759308 8:2057616-2057638 GGGGCAGATGGAGGACAAGCTGG + Exonic
1037939171 8:22938611-22938633 AGGGGTAATGGAGCACCTGCTGG - Intronic
1038265907 8:26039970-26039992 GGCGGGGCTGGAGCACCTGCGGG + Intronic
1038425308 8:27460772-27460794 GGGACATATGGAGCCCCTGCAGG + Exonic
1038568929 8:28643010-28643032 GAGGCAGATGGATCACCTGAGGG + Intronic
1040835187 8:51723692-51723714 TGGGCTGCGGGAGCACCAGCAGG + Intronic
1047960836 8:130010586-130010608 TGGGCTTATTCAGCACCTGCTGG + Intronic
1048354080 8:133639310-133639332 GGGGCTGCAGGAGAACCTTCTGG + Intergenic
1049670980 8:143869755-143869777 GGGCCTGCTGGAGGACGTGCAGG - Exonic
1049671693 8:143872914-143872936 GGAGCTGAAGGAGAAGCTGCTGG - Exonic
1049854138 8:144851038-144851060 GGGGCAGACGGAGGGCCTGCTGG + Exonic
1050355017 9:4774412-4774434 CAGGCTGATGGAGCAGCTACTGG + Intergenic
1051416545 9:16846781-16846803 GTGGCTGATGGAAAACCTGCTGG - Intronic
1052371311 9:27668016-27668038 GGTGCTGATGTAGAAGCTGCAGG - Intergenic
1052916679 9:33928631-33928653 GGGGCTGATGGAGCATCCGCTGG - Intronic
1053557692 9:39154828-39154850 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1053821806 9:41975116-41975138 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1054139422 9:61464123-61464145 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1054608765 9:67212292-67212314 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1055272343 9:74575318-74575340 AGGGAAGATGGAGGACCTGCAGG + Intronic
1055436554 9:76297499-76297521 GGGGAGGAATGAGCACCTGCAGG - Intronic
1056552019 9:87660020-87660042 GGGGCTGGGGGCGCCCCTGCGGG + Intronic
1056925565 9:90831257-90831279 GGGGAGGAGGCAGCACCTGCCGG + Intronic
1057015281 9:91645520-91645542 GCGGAAGATGGCGCACCTGCTGG + Intronic
1057806085 9:98220832-98220854 GGGGAAGATAGAGCACCTGAAGG - Exonic
1058877704 9:109258818-109258840 AGGGCTGCAGGAGCAACTGCGGG + Intronic
1059429436 9:114241137-114241159 GGGGCTGTTGGAGCACCAGGTGG + Intronic
1060240580 9:121898998-121899020 GGGGCTGATGGAGCAGGAGAGGG - Intronic
1060892259 9:127196376-127196398 GGAGCAGATGGTGCAGCTGCAGG - Intronic
1061028696 9:128067008-128067030 GGAGCTGAAGAAGCACCTGCTGG - Exonic
1061050182 9:128190722-128190744 GGGACTGCTGGAGCAGCTGCTGG + Exonic
1061084306 9:128390294-128390316 GTGGCTGGAGGAGCAGCTGCTGG - Exonic
1061836283 9:133332222-133332244 GCAGCTGCTGGAGCGCCTGCAGG - Exonic
1061848819 9:133402912-133402934 TGGGCTGCTGGAGCACATCCTGG + Exonic
1062321005 9:135990499-135990521 GGAGCTGTGGGAGCATCTGCAGG + Intergenic
1062533450 9:137011539-137011561 GGGCGTGATGGACCACCTGCGGG + Exonic
1062581456 9:137230909-137230931 GGTGGTGAGGGGGCACCTGCAGG - Exonic
1062678490 9:137762878-137762900 GGGGCTGTCGGGGCCCCTGCTGG - Intronic
1062699410 9:137891145-137891167 TGGGCTGATGGAGCACAGCCAGG + Intronic
1203466759 Un_GL000220v1:95461-95483 GAGGCTGACGGATCACCTGATGG - Intergenic
1186680648 X:11870362-11870384 GGGGAGGATGGAGCATCTCCAGG - Intergenic
1187173163 X:16870621-16870643 GGGGCTGATGGAGGCGCGGCTGG + Intergenic
1187933002 X:24311278-24311300 TGGGCTGCTGGAGCTGCTGCAGG + Intergenic
1187939210 X:24364884-24364906 TGGGCTGCTGGAGCTGCTGCAGG - Intergenic
1188248639 X:27864084-27864106 CGGGCTGGTGGAGCACGTGCTGG + Intergenic
1189333127 X:40155038-40155060 GGGGCTGGGGGAGTAGCTGCGGG + Intronic
1190342155 X:49305497-49305519 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190344406 X:49323836-49323858 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190345496 X:49333380-49333402 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190346598 X:49342946-49342968 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190347846 X:49533974-49533996 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190348947 X:49543530-49543552 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190350049 X:49553086-49553108 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190351152 X:49562639-49562661 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190352253 X:49572197-49572219 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190353353 X:49581746-49581768 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190355559 X:49600817-49600839 GAGGATGAGGGAGCATCTGCAGG + Exonic
1190688435 X:52894316-52894338 GCGGTTGATGGAGCAAGTGCAGG + Intronic
1190697548 X:52961476-52961498 GCGGTTGATGGAGCAAGTGCAGG - Intronic
1191875208 X:65788500-65788522 GGGGCAGAGGGAGCCCCAGCCGG - Intergenic
1200236105 X:154468479-154468501 GGGGCTGCTCAAGCAACTGCTGG + Exonic