ID: 1101986395

View in Genome Browser
Species Human (GRCh38)
Location 12:109450736-109450758
Sequence GTCAGATGGCCTTCCTGGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101986389_1101986395 15 Left 1101986389 12:109450698-109450720 CCAGGGAGGGGTAGTTTATGAGC 0: 1
1: 0
2: 1
3: 13
4: 88
Right 1101986395 12:109450736-109450758 GTCAGATGGCCTTCCTGGAGTGG 0: 1
1: 0
2: 4
3: 12
4: 187
1101986388_1101986395 16 Left 1101986388 12:109450697-109450719 CCCAGGGAGGGGTAGTTTATGAG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1101986395 12:109450736-109450758 GTCAGATGGCCTTCCTGGAGTGG 0: 1
1: 0
2: 4
3: 12
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101986395 Original CRISPR GTCAGATGGCCTTCCTGGAG TGG Exonic
900219983 1:1503327-1503349 GTGGGATGGCCTTCCTGATGTGG + Intergenic
900222290 1:1515755-1515777 GTGGGATGGCCTTCCTGATGTGG + Intronic
900615065 1:3561754-3561776 GTCAGATGGCCTGGCAGGACAGG - Intronic
900668294 1:3831103-3831125 GTCAGATGGGCCTCCTGGCCCGG - Exonic
900790376 1:4675949-4675971 GTCTGCTCGCCTTCCTGCAGGGG + Intronic
900810858 1:4800444-4800466 GCCTGAGGACCTTCCTGGAGAGG - Intergenic
901178184 1:7320433-7320455 GCCAGATGTCTTTCCTAGAGTGG - Intronic
902802751 1:18840436-18840458 GGCAGCTGGTCTTCCTGGAATGG - Exonic
902920880 1:19665407-19665429 GTCGGATGGGCTCCCTGGGGTGG - Exonic
904212375 1:28894543-28894565 GGCAACTGGACTTCCTGGAGAGG + Intronic
905477772 1:38240934-38240956 CTCAGGTGGGCTTCCTGGGGAGG + Intergenic
906201895 1:43965914-43965936 GGCAGATGGCCTGCCCCGAGTGG - Intronic
911718668 1:101165998-101166020 GGCAGATTGCCTGACTGGAGTGG - Intergenic
913159099 1:116129234-116129256 GTCAGGGGGCCTCCCTGGAGAGG + Intronic
915121314 1:153631020-153631042 GTCAGATGGCTTTCCTGAAGAGG + Exonic
918229319 1:182513856-182513878 ATCTGATTGCCTTCTTGGAGAGG - Intronic
918971659 1:191427733-191427755 GACATATTGCCTCCCTGGAGAGG - Intergenic
919315433 1:195966460-195966482 GGAAGATGGCTCTCCTGGAGAGG - Intergenic
919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG + Intronic
920390221 1:205595404-205595426 ATCAGAGGAGCTTCCTGGAGAGG - Intronic
924154468 1:241162082-241162104 GTCAGCTGACATTCCTGGGGAGG - Intronic
924707623 1:246512157-246512179 GTCAGATGACCCTCATGGGGAGG - Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1066332983 10:34445183-34445205 GTCAGATGACTTTCCGGGAATGG + Intronic
1067306028 10:45064902-45064924 GTGAGTTGGGCTTCCTGAAGGGG + Intergenic
1067715131 10:48684993-48685015 GCAAGGTGGCCTACCTGGAGGGG - Intronic
1067807598 10:49404064-49404086 GGCAGAGGGCAGTCCTGGAGAGG - Intergenic
1068003474 10:51364767-51364789 CTCAGATAGACTCCCTGGAGTGG + Intronic
1070681645 10:78453136-78453158 GTCATGGGGCCTTCCTGGAGAGG + Intergenic
1073473213 10:103736615-103736637 TTCAGAAGGCCTTCCTTGATTGG + Intronic
1073941703 10:108706670-108706692 TACAGATGGTCTTCCTGGAGTGG + Intergenic
1074524749 10:114253665-114253687 CTTACATGGACTTCCTGGAGAGG - Exonic
1075244661 10:120810538-120810560 GTCAGGGAGGCTTCCTGGAGGGG - Intergenic
1075625663 10:123962875-123962897 TTCCGGTGGGCTTCCTGGAGAGG - Intergenic
1075894245 10:125980891-125980913 TTCAGATGGCCTTCTGGGGGCGG - Intronic
1076093237 10:127707749-127707771 GTCTGATGGGCTTCCTGTTGTGG - Intergenic
1076572697 10:131442987-131443009 GTCAGATAATGTTCCTGGAGCGG + Intergenic
1076929244 10:133518670-133518692 GCCAGATGGCCCTCTTGGTGCGG - Intergenic
1077108176 11:850811-850833 GACAGGTCGCCTGCCTGGAGGGG - Intronic
1078058204 11:8024749-8024771 GTCAGATTGTCCTCCAGGAGGGG + Intronic
1078582460 11:12549092-12549114 GGCAGATGGTCTTCCAGAAGGGG + Intergenic
1080434002 11:32223344-32223366 GGCAGATGACCTTCCTGTGGAGG - Intergenic
1080772976 11:35359964-35359986 ATCAGTTTGCATTCCTGGAGAGG - Intronic
1080836533 11:35945028-35945050 GTCAGCTGTCCCTCCTGGACTGG + Intronic
1089329821 11:117681419-117681441 GCCAGAGGGCCTTCAAGGAGGGG - Intronic
1096411960 12:51383461-51383483 GTCAGGAGGCCTTCCTGGAGGGG - Exonic
1096638286 12:52975050-52975072 GGGAGAGGGGCTTCCTGGAGGGG + Intergenic
1096810869 12:54169037-54169059 GTCAGATTGCCTCCCATGAGAGG + Intronic
1101917749 12:108909097-108909119 GTCAGATGGCCAACATGCAGAGG + Intergenic
1101986395 12:109450736-109450758 GTCAGATGGCCTTCCTGGAGTGG + Exonic
1105435216 13:20371323-20371345 GTCTGATGGGCTTCCTGGTGGGG - Intergenic
1106356424 13:28987612-28987634 GACACATGCCCTGCCTGGAGGGG + Intronic
1112035917 13:95496586-95496608 GGCAGATTGAGTTCCTGGAGAGG + Intronic
1113068728 13:106397264-106397286 GTGAGATGGCCTGTGTGGAGGGG - Intergenic
1113087424 13:106582464-106582486 GTCAAAAGGCCATCCTGGTGAGG - Intergenic
1113182740 13:107650220-107650242 GTCAGGTGACCTTCCTAGACAGG - Intronic
1115395658 14:32905796-32905818 GTCTGATGTCCTGCCTGGGGTGG + Intergenic
1115455078 14:33592556-33592578 GGCAGAAGGGCATCCTGGAGGGG + Intronic
1116579709 14:46624087-46624109 GTCAGTTGCCCTTCCAGGATGGG - Intergenic
1116932398 14:50703108-50703130 GTCAGAAGGCCCTGGTGGAGTGG + Intergenic
1118081963 14:62371570-62371592 GTCAGAAAGCCTTTCTGTAGTGG - Intergenic
1118250873 14:64159771-64159793 GCCAGATGGGCATCCTGCAGGGG + Intronic
1120886733 14:89457647-89457669 GACAGATAGCCTTCATGTAGAGG - Intronic
1122549781 14:102543689-102543711 GTCTGTTGGGCTCCCTGGAGAGG - Intergenic
1125396616 15:39255645-39255667 TCCAAATGGCATTCCTGGAGGGG - Intergenic
1125891393 15:43269528-43269550 GTCAGGAAGACTTCCTGGAGGGG - Intergenic
1126597332 15:50395695-50395717 GTCACCTGACCTTCCTGGTGGGG + Intergenic
1126663394 15:51053820-51053842 ATCAGATGGCCTTCGAGAAGAGG - Intergenic
1128096247 15:64958832-64958854 GCCAGGTGGCCTGCCAGGAGTGG + Intergenic
1128913889 15:71542318-71542340 TTAAGATCTCCTTCCTGGAGGGG - Intronic
1129231275 15:74198460-74198482 GTCAGAGGGGCTCCCTGGAGAGG - Intronic
1129409490 15:75341264-75341286 GGCAGATGGGCTTCCAGGACTGG + Intronic
1131588872 15:93726768-93726790 GTCAGATGTCATACTTGGAGAGG + Intergenic
1132007214 15:98238989-98239011 GTGAGATGGGCTTCCTTGATTGG - Intergenic
1133987406 16:10678932-10678954 GACAGCTGGCTTTGCTGGAGAGG + Intronic
1137710944 16:50566498-50566520 GTCACATGCCTGTCCTGGAGTGG + Intronic
1140535973 16:75710066-75710088 GTCAGAAGTCATTCATGGAGGGG - Intronic
1141500307 16:84439503-84439525 GTCAGATGGGCTTCGTGCCGAGG + Exonic
1142225897 16:88877538-88877560 CTCAGGAGGGCTTCCTGGAGAGG - Intronic
1143495314 17:7308933-7308955 GTGGGAGGGCCTTCCAGGAGAGG + Intronic
1145912359 17:28550040-28550062 GCCAGGAGGGCTTCCTGGAGGGG - Intronic
1146708807 17:35022738-35022760 CTGAGTGGGCCTTCCTGGAGTGG - Intronic
1146847845 17:36195710-36195732 GCCAGAAGGCCATCCTGGAAAGG - Intronic
1147536698 17:41326508-41326530 GTCAGATGACCCTCATGGGGAGG + Intergenic
1148157122 17:45430898-45430920 GTCCGAGGGCCTTGCTGTAGAGG + Intronic
1148378048 17:47168040-47168062 GGCAGGTGGCTTGCCTGGAGAGG - Intronic
1148538075 17:48457258-48457280 ATCCGATTTCCTTCCTGGAGTGG - Intergenic
1148857593 17:50587229-50587251 GTCACATCACCCTCCTGGAGAGG - Intronic
1149601855 17:57898537-57898559 CTCAGATGGCGCTCCTGCAGGGG + Intronic
1154215145 18:12410266-12410288 ATCAGATGTCCTTCCAGGACAGG + Intronic
1157636047 18:49156279-49156301 CTCAGTTGGCCTTCCGTGAGAGG + Intronic
1157791234 18:50533005-50533027 GTCAGATGGGGTGGCTGGAGAGG + Intergenic
1159745774 18:72232854-72232876 GTCAGCTGACATTCCTGGTGTGG + Intergenic
1160309982 18:77779975-77779997 GTCAGAGGTCCTGCATGGAGTGG - Intergenic
1161211036 19:3065847-3065869 GGCAGGTGGCCTCCCAGGAGAGG - Intergenic
1165794481 19:38510991-38511013 TTGAGTTGGCCTTCCTGGACAGG - Intronic
1167016119 19:46842260-46842282 GTCTGGAGGGCTTCCTGGAGGGG - Intronic
1167281052 19:48568798-48568820 GTCCGATCGCATTCCTGGAAGGG + Intronic
1167421083 19:49403760-49403782 GGCAGCAGGCCTTCCTGGTGGGG - Intronic
1168291217 19:55358618-55358640 GCCAGCTGTCCTTACTGGAGGGG - Exonic
925003097 2:421683-421705 GTCACGTGGCCTTCGTGGTGAGG + Intergenic
925309147 2:2869775-2869797 ATCAGCTGGCCTTTCTGAAGAGG + Intergenic
929818127 2:45252134-45252156 GTCAGACCACCTTGCTGGAGAGG - Intergenic
932282894 2:70509921-70509943 GTCATAACTCCTTCCTGGAGAGG + Intronic
933779504 2:85791818-85791840 GTCCCGTGGCCTCCCTGGAGTGG + Intergenic
934076314 2:88431546-88431568 GTTATATGGACATCCTGGAGAGG - Intergenic
935429640 2:102961324-102961346 GTGTGGTGGCCTTCCTTGAGGGG + Intergenic
935658078 2:105441954-105441976 GTCAGAGGGCCTTGCTGCTGAGG - Intergenic
936459252 2:112700089-112700111 GTCAGATTGCCTTCCAGAAGTGG + Intergenic
937775778 2:125774291-125774313 GGCAGATGGCTTACCTGGACAGG + Intergenic
937911634 2:127078383-127078405 GTCAGTGAGACTTCCTGGAGTGG + Intronic
938344785 2:130559251-130559273 GTGAGAAGGCCCTGCTGGAGTGG - Intergenic
938345048 2:130561469-130561491 GTGAGAAGGCCCTGCTGGAGTGG + Intergenic
938410955 2:131064049-131064071 TACAGATGGGCTTCCTGGGGAGG - Intronic
939714396 2:145565570-145565592 TTCTGATGGCCTTACAGGAGTGG + Intergenic
941539639 2:166766445-166766467 GTCACCTGACCTTCCTGGTGTGG + Intergenic
941613510 2:167692000-167692022 ATTAGTTGGCCTTCCTTGAGTGG + Intergenic
945181117 2:207092281-207092303 CTCACATGCCCTTCCTGGACTGG - Intronic
946465333 2:219906907-219906929 CTCAGATAGCCAACCTGGAGTGG + Intergenic
947905780 2:233760892-233760914 ATCACATGACCTTCCTGCAGCGG + Exonic
1170551328 20:17480019-17480041 TGGAGATGGCCTTCTTGGAGTGG - Intronic
1171200756 20:23240155-23240177 GTCACCTGGCATTCCTGGTGGGG + Intergenic
1171318145 20:24214071-24214093 GTCAGATGACCTTTATGGAAAGG - Intergenic
1172119537 20:32589644-32589666 GTCAGGAGGCCTTTCTAGAGAGG - Intronic
1172178348 20:32986038-32986060 GTCAGGAGAGCTTCCTGGAGGGG - Intronic
1173643349 20:44618517-44618539 GGCAGAGGGCTTTCCCGGAGTGG - Exonic
1173905700 20:46626956-46626978 CAGAGATGGACTTCCTGGAGGGG - Intronic
1174174575 20:48636696-48636718 GGCAGGAGGCCTTGCTGGAGGGG + Intronic
1174844541 20:53930453-53930475 GTCACACGTCCTTCCTGGTGGGG + Intergenic
1176033130 20:63023423-63023445 TTCAGGAGGGCTTCCTGGAGGGG + Intergenic
1178544136 21:33479524-33479546 GTCAGGTTGCGTTCCTGGGGAGG - Intronic
1179597395 21:42452080-42452102 GCCAGGAGGGCTTCCTGGAGGGG - Intergenic
1179613376 21:42566375-42566397 GTCAGCTGCCCCTCCAGGAGCGG + Intronic
1181276238 22:21688854-21688876 GTCAGCTGGGCTTGCTGGGGTGG + Intronic
950425075 3:12920800-12920822 GGCACATGGCCGTCCTGGGGAGG + Intronic
953413505 3:42702763-42702785 AGGAGGTGGCCTTCCTGGAGCGG + Exonic
956770562 3:72522547-72522569 ATCCACTGGCCTTCCTGGAGAGG + Intergenic
959598521 3:108153403-108153425 TTCAGGTAGCCTTCCGGGAGGGG - Intergenic
961036126 3:123643028-123643050 TTCAGCTGGCCTCCCAGGAGTGG - Intronic
961386220 3:126524726-126524748 GGGAGATGGCCTTCCCGGATTGG - Intronic
967873548 3:194251406-194251428 GGCTCATGGCCTTTCTGGAGGGG + Intergenic
968903063 4:3440157-3440179 GTCTGAGGGCCTTTCTGGGGAGG + Intergenic
968910693 4:3475764-3475786 GAGAGAGAGCCTTCCTGGAGAGG + Intronic
968984785 4:3869230-3869252 CTCAGATGGCCTCCCTGTGGTGG + Intergenic
970470296 4:16371645-16371667 GTCTGATGGGCTTCCCGTAGTGG + Intergenic
973293371 4:48490857-48490879 GTCTCACCGCCTTCCTGGAGGGG + Exonic
974464371 4:62235262-62235284 TTCAGAGGGCTTTCCTGGAATGG - Intergenic
977002374 4:91519596-91519618 GTCTGAAGGCCTTGGTGGAGTGG + Intronic
978339403 4:107706790-107706812 GCCAGATGGCCTTCCCAGATTGG - Intronic
979188873 4:117833175-117833197 ATCACACTGCCTTCCTGGAGAGG - Intergenic
980219890 4:129901164-129901186 CTGAGATGTCCTTCCTAGAGGGG - Intergenic
981793389 4:148566014-148566036 GTCTGATGTCCTGCCTGGACAGG - Intergenic
985126869 4:186703130-186703152 ATCATCTGCCCTTCCTGGAGAGG - Intronic
985141803 4:186847693-186847715 GTCAGATGCCCATCCTTCAGTGG + Intergenic
991043004 5:62194787-62194809 GGCAGATGGCCTTCCTCTTGTGG + Intergenic
991925670 5:71703021-71703043 CTCAAAAGGCTTTCCTGGAGAGG + Intergenic
991951177 5:71948065-71948087 GTCAGGAGGGCTACCTGGAGAGG - Intergenic
996827864 5:127705646-127705668 GTCAGAGGGCCTTCAGGGAGAGG + Intergenic
999246067 5:150155450-150155472 GTAAGGAGGACTTCCTGGAGGGG - Exonic
999600346 5:153255868-153255890 GTCAGATGTCCTTCCAGGAATGG + Intergenic
1000818597 5:165955715-165955737 GTCACATGGGCACCCTGGAGTGG - Intergenic
1000916783 5:167092407-167092429 GTCAGATAGCTTTCCTAGAAAGG - Intergenic
1001104626 5:168842720-168842742 CTCAGACTGCCTTCCTGGTGAGG + Intronic
1001522257 5:172403112-172403134 AGCCGATTGCCTTCCTGGAGTGG + Intronic
1001890702 5:175335778-175335800 GTCAGTAGGCCTTTCTGGAAAGG + Intergenic
1002212144 5:177605373-177605395 GGCAGAGGGCCTTCCTGGCAGGG - Intronic
1004057590 6:12155782-12155804 GTCAGATGGTATTTCTGCAGAGG + Intronic
1006445292 6:34076585-34076607 GTCAGCTGGCCTTGGTGGAGGGG + Intronic
1006996594 6:38266978-38267000 GGCAGATGGCCTTGCTGGAGAGG - Intronic
1011839272 6:91476149-91476171 GTCACATGGCCCTTCTGAAGTGG + Intergenic
1013583675 6:111560043-111560065 GTCAGACTGCCCTCATGGAGTGG + Intronic
1014834637 6:126147070-126147092 ATAAGATGACCTTCCTGAAGAGG + Intergenic
1019768960 7:2871340-2871362 GTCAGGGAGGCTTCCTGGAGAGG + Intergenic
1022519274 7:30995358-30995380 GGCAGAAGGCCGTCCTGGACAGG + Intergenic
1023173282 7:37410733-37410755 GTCAGGTTGCCTTCCTTTAGGGG - Intronic
1023328518 7:39086733-39086755 GACAGATGTCTTTGCTGGAGTGG - Intronic
1024929064 7:54650714-54650736 GCCAGATGGCCTTTGTGTAGGGG + Intergenic
1025711243 7:63911888-63911910 GTCAGCAGGCCTGCCTAGAGGGG + Intergenic
1026988941 7:74572129-74572151 GTGGGATGGGCTTCCTGGAGAGG + Intronic
1028667345 7:93362285-93362307 GGCAGAAGGCCTCCCTTGAGAGG + Intergenic
1028688003 7:93614272-93614294 TTCAGATTGCCATTCTGGAGAGG + Intronic
1029008762 7:97236580-97236602 GTCTGATGGCCTTCCTTTTGTGG - Intergenic
1031989698 7:128189568-128189590 AGCAGGTGGCCTTCCTGGTGAGG + Intergenic
1032312402 7:130800911-130800933 GTCTGATGGGCTTCCTTGTGTGG + Intergenic
1033977004 7:147115186-147115208 GTCAGATGGGCTTCCCTTAGTGG + Intronic
1034673142 7:152872414-152872436 GTCAGGTGGCCATGCAGGAGGGG + Intergenic
1035644711 8:1210224-1210246 CTCAGGTGACCTTCCTGGAGAGG + Intergenic
1045324098 8:101103955-101103977 GTGGGGTGGCCTTCCTGGACGGG - Intergenic
1047343193 8:124002328-124002350 GACACCTGGCCTGCCTGGAGAGG + Intronic
1048372926 8:133795391-133795413 CTCTGATGGCCTTCCTGGAGTGG - Intergenic
1051164503 9:14247526-14247548 GTCAGATGGCCCTCCTGACCTGG - Intronic
1057865796 9:98679734-98679756 GTCAGAAGACCCTCATGGAGAGG + Intronic
1059638856 9:116196433-116196455 GTCAGATGCCCTTCCAGGTTAGG + Intronic
1059971181 9:119669857-119669879 CTCACAGGGCCTTCCTGCAGTGG + Intergenic
1060407576 9:123380487-123380509 GGCAGCTGGCCTTCCTGGGTTGG - Exonic
1060563662 9:124569370-124569392 GTAAAATGCCCTTCCTGGGGTGG - Intronic
1060999527 9:127895311-127895333 GTAAGATGCCCTTACTGGAGAGG - Intronic
1187499514 X:19828017-19828039 GTCAGGTGACCCTCCTGGCGGGG - Intronic
1190109154 X:47578761-47578783 GAGAGATGGCATTCCCGGAGGGG + Intronic
1191768721 X:64732353-64732375 GTCCTGTGCCCTTCCTGGAGTGG + Intergenic
1195219952 X:102737464-102737486 GTCAGAAGTCATTCATGGAGGGG + Intronic
1198485422 X:137082468-137082490 GTCAGAGAGCCTTGGTGGAGTGG - Intergenic
1200228589 X:154432777-154432799 GTGGGATGGGCTTCCAGGAGGGG + Intronic
1200836776 Y:7740054-7740076 GCCACATGGCCATCCTGCAGTGG + Intergenic