ID: 1101988042

View in Genome Browser
Species Human (GRCh38)
Location 12:109462582-109462604
Sequence CACTCATTTATTGTGCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101988042_1101988048 -4 Left 1101988042 12:109462582-109462604 CCAGTAAGCACAATAAATGAGTG 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1101988048 12:109462601-109462623 AGTGCAGCTGGGCGGGGCTGAGG 0: 1
1: 0
2: 6
3: 58
4: 707
1101988042_1101988052 10 Left 1101988042 12:109462582-109462604 CCAGTAAGCACAATAAATGAGTG 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1101988052 12:109462615-109462637 GGGCTGAGGCTGGGGCTGACAGG 0: 1
1: 3
2: 12
3: 152
4: 805
1101988042_1101988049 0 Left 1101988042 12:109462582-109462604 CCAGTAAGCACAATAAATGAGTG 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1101988049 12:109462605-109462627 CAGCTGGGCGGGGCTGAGGCTGG 0: 1
1: 1
2: 13
3: 215
4: 1321
1101988042_1101988047 -10 Left 1101988042 12:109462582-109462604 CCAGTAAGCACAATAAATGAGTG 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1101988047 12:109462595-109462617 TAAATGAGTGCAGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 45
4: 343
1101988042_1101988051 2 Left 1101988042 12:109462582-109462604 CCAGTAAGCACAATAAATGAGTG 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1101988051 12:109462607-109462629 GCTGGGCGGGGCTGAGGCTGGGG 0: 1
1: 3
2: 17
3: 165
4: 1238
1101988042_1101988050 1 Left 1101988042 12:109462582-109462604 CCAGTAAGCACAATAAATGAGTG 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1101988050 12:109462606-109462628 AGCTGGGCGGGGCTGAGGCTGGG 0: 1
1: 0
2: 8
3: 95
4: 754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101988042 Original CRISPR CACTCATTTATTGTGCTTAC TGG (reversed) Intronic
906096253 1:43226199-43226221 AACTATTTTATTCTGCTTACAGG + Intronic
906576256 1:46893036-46893058 CACTTAATTATTGTGCCCACAGG - Intergenic
906595665 1:47074550-47074572 CACTTAATTATTGTGCCCACAGG + Intronic
907249984 1:53131645-53131667 CAATCATGCATTGTGCTTTCTGG - Intronic
909178953 1:72396232-72396254 CACTCAGTCATTGTTCTTATGGG - Intergenic
909240930 1:73212357-73212379 CATTCATTTAATGTACTTTCTGG - Intergenic
909460118 1:75902118-75902140 TACTCATTTCTTGTTCTTAAAGG + Intronic
909779300 1:79522492-79522514 GACACATTTTTTGTGCTTATTGG - Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
921818198 1:219587520-219587542 CACTCATTTATGTTACTTTCTGG - Intergenic
922409937 1:225362959-225362981 AACTCATTTAGTGGGATTACAGG + Intronic
1067707534 10:48621070-48621092 CAATCATGTATTGGGCTTTCTGG - Intronic
1072758661 10:98038096-98038118 CCCTCATCTATGGTGCGTACAGG - Intergenic
1079857458 11:25623983-25624005 CAATCATTTATTATTCTTAAGGG - Intergenic
1080755142 11:35190063-35190085 CAGTGATTTATTCTCCTTACTGG - Exonic
1080921262 11:36711643-36711665 TACTCATTTTTCGTTCTTACTGG + Intergenic
1086856546 11:91872501-91872523 CATTGATTTATTGTGCACACAGG - Intergenic
1089778134 11:120853518-120853540 CACTCATTTATTGTCATTTGAGG - Intronic
1091330816 11:134729680-134729702 CACTAATTTATTGGGGTTCCAGG - Intergenic
1093042132 12:14393919-14393941 CATTCATGTATTGTTTTTACTGG - Intronic
1093936972 12:25011825-25011847 CATTCATTTCTTGTGATTAGTGG + Intergenic
1095941046 12:47727070-47727092 CACTCTTTAGTTGTGCTTCCGGG - Intergenic
1101016344 12:100504843-100504865 CAATCATTTCTTTTGTTTACAGG - Intronic
1101988042 12:109462582-109462604 CACTCATTTATTGTGCTTACTGG - Intronic
1103815501 12:123652034-123652056 CACTCATTTATTAAGCTTCAGGG - Intronic
1104054534 12:125219482-125219504 CACACCTTTATTGTGCCTAGGGG - Intronic
1106657032 13:31757446-31757468 CACTCATCTATCGTGTCTACTGG - Intronic
1107064981 13:36203627-36203649 TACTCATATATACTGCTTACGGG - Intronic
1111557076 13:89894726-89894748 TACTTATTTATATTGCTTACTGG + Intergenic
1113061269 13:106324711-106324733 CACTCTTGTATTGTCCATACAGG + Intergenic
1113305111 13:109069055-109069077 CTTTCATTTATTCTGGTTACAGG - Intronic
1116534182 14:46010125-46010147 CAGTCATTAATTGTCCTAACGGG - Intergenic
1120075581 14:80153973-80153995 CACTCATTCATGGAGCTAACTGG + Intergenic
1120805518 14:88744752-88744774 AATTCATTTATTCTGCTTTCTGG + Intronic
1127527645 15:59809606-59809628 CATTCATTTATTTTGCTTTGGGG - Intergenic
1127745750 15:61970355-61970377 AACTATTTTATTTTGCTTACAGG - Intronic
1137499889 16:49002691-49002713 CACTCATTGAATATGGTTACAGG - Intergenic
1142999864 17:3786491-3786513 CTTTCATTTATTGTGCTTGCTGG - Intronic
1143458355 17:7082721-7082743 TACTCATTTATTTTGTTTATTGG - Intergenic
1149952193 17:61000666-61000688 TACTCATTTATTCTGTTTTCTGG - Intronic
1156090182 18:33458138-33458160 CAAGCATTTATTATCCTTACTGG + Intergenic
1164850734 19:31481809-31481831 CACTCATTGATTTTGTTTTCAGG - Intergenic
1165132050 19:33639005-33639027 CAGTCAAATATTGTGCTTAAAGG + Intronic
1168533294 19:57147339-57147361 TATTTATTTATTGTGTTTACTGG - Intergenic
928274524 2:29887838-29887860 CAATCTTTTCTTGTGCTTACTGG + Intronic
931918550 2:66986725-66986747 CAAGCATATATTGTGCTTGCTGG + Intergenic
936540409 2:113345355-113345377 CACCCATTTTTTCTGCTTACTGG + Intergenic
937029631 2:118727678-118727700 AACTAATTTATTGTCCTTAAAGG + Intergenic
938695650 2:133833122-133833144 GTCTCATTCATTGTCCTTACTGG - Intergenic
939945876 2:148410300-148410322 GCATCATTTATTATGCTTACTGG + Intronic
943458135 2:188133869-188133891 CATTCATATATTTTGCTTAAAGG + Intergenic
947574713 2:231263651-231263673 CATTCATCTGTTGTGCATACAGG + Intronic
947693163 2:232158778-232158800 AACTCATTTATTATTCTCACAGG - Intronic
1173385232 20:42581350-42581372 TACTCATTTATTATGCTAATTGG + Intronic
1174934217 20:54849921-54849943 CACTCTCTCATTGTGCTTCCTGG + Intergenic
1179389970 21:40979286-40979308 CATTCATTTATGGTTCTTATGGG - Intergenic
1182688098 22:32136255-32136277 CTCTCAATTCTTGTGTTTACAGG - Intergenic
955518676 3:59753030-59753052 CATTCATTTATTTTACTTCCTGG + Intronic
955755499 3:62221337-62221359 CACTCATTTTTTGTGCTACTGGG - Intronic
960475564 3:118120459-118120481 CACTAATGTATTTTGCTTAGGGG - Intergenic
960652400 3:119965740-119965762 CATTCATTTATTGTGTTCAAAGG + Intronic
962137399 3:132750105-132750127 CACTTTTTTAATGTGCTTATTGG + Intergenic
969028111 4:4190750-4190772 CTCTCTTTTACTTTGCTTACTGG + Intronic
970628948 4:17920549-17920571 CACTGATTGATTCTGCTTTCAGG + Intronic
973115572 4:46453962-46453984 TACTCATTTATTGTATTTTCAGG + Intronic
973688118 4:53395522-53395544 TAGGCATTTATTGTGCTTAATGG + Intronic
974956931 4:68652894-68652916 CCCTCTTTTCATGTGCTTACTGG - Intronic
977749742 4:100595143-100595165 CAGCTATTTAGTGTGCTTACTGG - Intronic
977901152 4:102423847-102423869 CAATCATTTATTATGCCTAAGGG - Intronic
980500101 4:133639257-133639279 CACACACTTATTGTCCTCACTGG + Intergenic
980531495 4:134061545-134061567 CACTTCTTGATTGTTCTTACAGG - Intergenic
981928228 4:150162904-150162926 CACTCACTTATTCTGCCTCCTGG + Intronic
982621924 4:157718723-157718745 CATTCATTGATTGTACTTATGGG + Intergenic
983482965 4:168297978-168298000 CACTCATTTATTGTGTATAGTGG - Intronic
992927004 5:81598476-81598498 TAATCATTTATTGTGCTTATGGG - Intronic
994050038 5:95352086-95352108 CCCTCAGTTATAGTTCTTACAGG + Intergenic
996716422 5:126591585-126591607 TAATCATTTAAAGTGCTTACTGG - Intronic
1000185480 5:158853885-158853907 CACTCATTGATTGACCTTCCTGG - Intronic
1006765300 6:36499687-36499709 CACTCCATTCTTGGGCTTACTGG - Intronic
1009780841 6:68267398-68267420 CACTCATTCATTCTCCTTCCTGG + Intergenic
1010194298 6:73224348-73224370 TTCTCACTTCTTGTGCTTACAGG - Exonic
1012166843 6:95965276-95965298 CATTGATTTATTGTGGTTACCGG - Intergenic
1014699499 6:124666166-124666188 AACACATTTATTTTGTTTACTGG - Intronic
1014970262 6:127806032-127806054 CACTCAATTTTAGTGATTACAGG + Intronic
1016375844 6:143419688-143419710 CACCCATTTGTCCTGCTTACTGG + Intergenic
1017937001 6:159014674-159014696 CATGCATTTATTGTGCTCAAGGG + Intergenic
1020851570 7:13360144-13360166 CTATCATTTCTTATGCTTACTGG + Intergenic
1021914445 7:25417578-25417600 CACTCATTTATTATTATGACTGG + Intergenic
1021964073 7:25900318-25900340 CCCTCATTAATTGTGCTGACAGG + Intergenic
1022179861 7:27908697-27908719 AAGTCATTTGTTGTTCTTACAGG - Intronic
1022607507 7:31830393-31830415 CACTCATTTTTTTTTCTTCCAGG + Intronic
1025243836 7:57300812-57300834 AATTCATTTATTGAGCCTACGGG + Intergenic
1025822033 7:64972980-64973002 AATTCATTTATTGTGTTCACAGG - Exonic
1029585387 7:101467491-101467513 CAATCTTTTATTGTGCAGACGGG + Intronic
1033479546 7:141725839-141725861 CAGTCATTCATTGTGACTACAGG - Intronic
1033940847 7:146651227-146651249 CACACATTTCTTGTGCTTTCTGG - Intronic
1035283981 7:157794718-157794740 CACACATTTATCGTGGTTTCAGG - Intronic
1037138855 8:15495880-15495902 TACTCATTTATTTTGCCTCCAGG + Intronic
1038938667 8:32280099-32280121 CATTCATTTATTATTCATACAGG - Intronic
1041163190 8:55065723-55065745 CACTCCCCTATTGTGCTGACTGG + Intergenic
1041837257 8:62230400-62230422 CACTCATCTACTGTGGTTTCAGG + Intergenic
1045513074 8:102830075-102830097 CACTCTTTTCTTGTGCTCATTGG - Intronic
1052231543 9:26160402-26160424 AACTCTTTTTTTGTGCTTATTGG - Intergenic
1057137565 9:92704217-92704239 TACTGATTTTTTTTGCTTACCGG + Intergenic
1058275582 9:103037694-103037716 CACTCCTTTCTTGTACTTACAGG + Intergenic
1189748586 X:44195387-44195409 CACACATTTATTTAGCTTACAGG - Intronic
1195252027 X:103058309-103058331 TACTCATTTATAATGCTCACAGG + Intergenic
1201186469 Y:11408755-11408777 CATTCATATTTTGTGCTTTCTGG - Intergenic
1201911950 Y:19141737-19141759 CACACATTTATTTTGCTAAAGGG + Intergenic