ID: 1101988122

View in Genome Browser
Species Human (GRCh38)
Location 12:109463164-109463186
Sequence CATCAAAGGCAGAACGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 3, 3: 102, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101988122_1101988127 10 Left 1101988122 12:109463164-109463186 CCTTCCACGTTCTGCCTTTGATG 0: 1
1: 1
2: 3
3: 102
4: 208
Right 1101988127 12:109463197-109463219 TCAGCTGCTTGGGAAGACCCAGG 0: 1
1: 0
2: 3
3: 23
4: 414
1101988122_1101988126 0 Left 1101988122 12:109463164-109463186 CCTTCCACGTTCTGCCTTTGATG 0: 1
1: 1
2: 3
3: 102
4: 208
Right 1101988126 12:109463187-109463209 TCTGCAGAACTCAGCTGCTTGGG 0: 1
1: 0
2: 0
3: 23
4: 222
1101988122_1101988125 -1 Left 1101988122 12:109463164-109463186 CCTTCCACGTTCTGCCTTTGATG 0: 1
1: 1
2: 3
3: 102
4: 208
Right 1101988125 12:109463186-109463208 GTCTGCAGAACTCAGCTGCTTGG 0: 1
1: 0
2: 1
3: 28
4: 310
1101988122_1101988128 11 Left 1101988122 12:109463164-109463186 CCTTCCACGTTCTGCCTTTGATG 0: 1
1: 1
2: 3
3: 102
4: 208
Right 1101988128 12:109463198-109463220 CAGCTGCTTGGGAAGACCCAGGG 0: 1
1: 0
2: 3
3: 18
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101988122 Original CRISPR CATCAAAGGCAGAACGTGGA AGG (reversed) Intronic
900605822 1:3523112-3523134 CATCACAGGCAGGACCGGGAGGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904413146 1:30337133-30337155 CATCAAAGGAAGGAGCTGGAAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906319435 1:44807233-44807255 GGCCAAAGGCAGAAGGTGGAAGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906592859 1:47044383-47044405 CATCAAAGACATAAAATGGAGGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907346064 1:53781550-53781572 CATTAAAGGCAAAATGTGAAAGG - Intronic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912538414 1:110394055-110394077 CAACAAAGGCAAAAGGAGGATGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913030847 1:114901465-114901487 AATCCAAGGCAGTGCGTGGAGGG + Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914897530 1:151690228-151690250 CATGAATGGCAGAAAGTCGAAGG - Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
924611979 1:245580856-245580878 CAGCATGGGCAGAACGAGGAAGG - Intronic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065571357 10:27073383-27073405 CATGCAAGCCTGAACGTGGAGGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1071871138 10:89795973-89795995 CAACCAAGGCAGAAGGTGAAGGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073306686 10:102508431-102508453 CATCAAAGGTAGAGCTGGGATGG - Intronic
1075056438 10:119222374-119222396 CAGCACAGGCAGCACTTGGAGGG - Intronic
1075223960 10:120608679-120608701 AATCAGAGGCAAAACATGGAGGG + Intergenic
1075851549 10:125592312-125592334 CATCAAAGACAGACTGTGGCTGG - Intronic
1076479623 10:130776383-130776405 CAACAAAGGCAGAAAGTGAAGGG - Intergenic
1076497478 10:130906326-130906348 CAGCAAAGGCAGAGTCTGGACGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078589584 11:12627705-12627727 CTTCAAAGGCATGACTTGGAGGG - Intergenic
1079343930 11:19635565-19635587 CACTCATGGCAGAACGTGGAAGG + Intronic
1079522208 11:21341216-21341238 CAGCAAAGGCAGAATGTTGCAGG + Intronic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1082830941 11:57616714-57616736 CAACAAAGTCAGGAGGTGGAAGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083191290 11:61054136-61054158 CCTCAAAGACAGTATGTGGATGG + Intergenic
1084466931 11:69328798-69328820 CATTAAAGGAATAACTTGGATGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085794531 11:79525923-79525945 CATAAAAGCCAAAAAGTGGAAGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG + Intergenic
1090805642 11:130200393-130200415 CATCCATGGCAGAAGGTGAAGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090986792 11:131774264-131774286 CATCTCAGGCAGAACAGGGATGG + Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091686537 12:2566653-2566675 AACCACAGGCAGAAGGTGGAGGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092947337 12:13468987-13469009 GATCAAAGCAAGAATGTGGAGGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098444859 12:70556059-70556081 CATCAAAGTCAGAATCAGGAGGG + Exonic
1099003778 12:77213288-77213310 CAGCAAAGGCCCAACATGGAGGG - Intergenic
1099627929 12:85099657-85099679 CATCAAAGGCACAAGGAGTAGGG + Intronic
1099713335 12:86257728-86257750 CATAAAAGTCAGAACTTGGGAGG - Intronic
1100124472 12:91407034-91407056 CATCCAAAGCAGAATGTGGCTGG + Intergenic
1101080083 12:101173007-101173029 CATCAAGGGCTGAAGGTGGCTGG - Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1104198988 12:126568689-126568711 CCTCAAAGTCAGAGTGTGGAAGG + Intergenic
1106771739 13:32967995-32968017 CATGTAAGGCAGACCCTGGAAGG + Intergenic
1106895741 13:34300426-34300448 CCTCAAAGGCAGAAAGAGAAAGG + Intergenic
1107525918 13:41231131-41231153 TATTAAAGACAGAAAGTGGATGG + Intronic
1107556349 13:41519543-41519565 ATGCAAAGGCAGAACGCGGAAGG - Intergenic
1107905670 13:45058809-45058831 CATAAAAGTGAGAACGTGGCTGG + Intergenic
1108562869 13:51664047-51664069 AATGAAAGGAAGAAAGTGGAAGG + Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1109991676 13:70066800-70066822 CATCAAAGGTAAAACATGGATGG - Intronic
1111108674 13:83678342-83678364 CATTAAAGGCAGACCTGGGATGG + Intergenic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112339526 13:98541507-98541529 CATCAGAGCCAGAAAGTGGGAGG + Intronic
1112343455 13:98571335-98571357 CATCAAAGTCAGAAAGAGGGTGG + Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117770692 14:59131247-59131269 CATCAAAAGCAGTAGGTGGCAGG - Intergenic
1118626963 14:67668424-67668446 ATTCAAAGGCAGAAAGTGAATGG + Intronic
1119577960 14:75745100-75745122 CATCACTGGCAGAGAGTGGACGG - Exonic
1120982273 14:90300840-90300862 AAACAAAGGCAGAAAGGGGATGG + Intronic
1122057949 14:99117861-99117883 CCTCAAAGGCAGCAAGGGGACGG - Intergenic
1122281100 14:100622895-100622917 GATCAAATGCAGAATGTGGGTGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123827605 15:24099361-24099383 CATCAAAGGCAGGACCAGCAGGG + Intergenic
1123842063 15:24258743-24258765 CATCAAAGGCAGGACCAGCAGGG + Intergenic
1123857080 15:24424821-24424843 CATCAAAGGCAGGACCAGCAGGG + Intergenic
1123861713 15:24475349-24475371 CATCAAAGGCAGGACCAGCAGGG + Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128244967 15:66126819-66126841 CACCAAAGCCAGAACGGGCAAGG + Intronic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1130689819 15:86072251-86072273 CAGCAAAGGCAGTACATAGAGGG + Intergenic
1131866392 15:96715828-96715850 CATTAAAGGCAGTAAGTGGTAGG + Intergenic
1133365206 16:5203715-5203737 CATCAGAAGGAGACCGTGGAGGG + Intergenic
1136479630 16:30533447-30533469 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136483408 16:30556406-30556428 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139848829 16:69938749-69938771 CTCTAAAAGCAGAACGTGGATGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140632615 16:76872273-76872295 CATGAAAGGCAGAACATAGAGGG - Intergenic
1141109871 16:81263385-81263407 TATAAAAGGCAGAACATGGTTGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144161730 17:12566731-12566753 CATCCAAGGCATCACATGGAAGG + Intergenic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1149158575 17:53664061-53664083 CACCAAAGGGAGAAATTGGAAGG - Intergenic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152493117 17:80651198-80651220 CTTCTAAGTCAGAAAGTGGAAGG + Intronic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1153133241 18:1882074-1882096 CATCACAGGTAAAACGAGGAAGG - Intergenic
1155079217 18:22391226-22391248 CATCACTGGGAGAATGTGGATGG - Intergenic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1157516273 18:48313861-48313883 GATCATAGGCAGAACATGAATGG + Intronic
1159616522 18:70586418-70586440 CATCAAAAACAAAATGTGGAGGG + Intergenic
1160211555 18:76884786-76884808 CAACAAAAGAAGAACGTGGGAGG - Intronic
1160434243 18:78833181-78833203 CTTCAAACGCTGCACGTGGAAGG + Intergenic
1161115936 19:2496356-2496378 AAACAAAGGTAGAATGTGGAAGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163044000 19:14625606-14625628 CATCAAAGGAAATACCTGGATGG + Intronic
1163615343 19:18323984-18324006 CGACAAAGGCAGAACGCGGAAGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166537820 19:43586112-43586134 CATCAAAAGCAGAACAGGCATGG - Exonic
1167318917 19:48783486-48783508 CAGCCAAGGGAAAACGTGGATGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925644709 2:6023940-6023962 CACCAGAGGGAGAAGGTGGAAGG + Intergenic
926638743 2:15212398-15212420 CACCAAAAGAAGAAAGTGGAAGG - Intronic
927183914 2:20468472-20468494 CCTCAAAGGCAGAACTGAGAAGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928980979 2:37134912-37134934 CATTAAAGGAATGACGTGGATGG - Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931239215 2:60437641-60437663 CTTCAAAGGAAGCACTTGGAGGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
932252589 2:70257899-70257921 CATCGAAGGCAGAAGCTGGCCGG - Intronic
932882181 2:75513029-75513051 CAAAAAAGGCAGAAAATGGAAGG - Intronic
935099457 2:99978978-99979000 GATCAAAGGCAGGTGGTGGAAGG + Intronic
935155275 2:100478982-100479004 CATCCAAGGGAAAAGGTGGAGGG - Intronic
935286552 2:101568906-101568928 CATAAAAGGCAGAATTTGGGGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935646005 2:105335306-105335328 CATCAAAGGAAAAAAGTGGCAGG - Intergenic
938049522 2:128155288-128155310 CATCAAAGACACAAGGTTGATGG - Intronic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939208566 2:139141040-139141062 CATCAAGGGATGAAGGTGGAGGG + Intergenic
940280552 2:151984631-151984653 CATCAAAGGCTGAATGTGAAAGG - Intronic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940761956 2:157748554-157748576 CATCAAGGGCAGAAACTGCAAGG + Intronic
941491668 2:166149710-166149732 TATCAAATTCAGAACGTGGTGGG + Intergenic
942218922 2:173750326-173750348 GATTAAAGGCAGAAAGAGGAAGG - Intergenic
942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943971844 2:194419794-194419816 CATCAAGGGCAGAAGTAGGAAGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946078092 2:217092458-217092480 CATCTAAGTCAGAAAGTGGTTGG - Intergenic
947532014 2:230915273-230915295 CATCAATGGCAGCACTGGGATGG - Intronic
948474216 2:238206296-238206318 CATTAAAGGAATGACGTGGATGG + Intergenic
948507612 2:238440470-238440492 CAACACAGGCAGTATGTGGAGGG - Intronic
1168845303 20:940390-940412 CAGCAAAGGCAGAGGGTGGGAGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170602377 20:17850511-17850533 CAGCAAAGGCACATCGTGAAGGG + Intergenic
1171226484 20:23445862-23445884 CAGCAAAGGCAAAAGGTGCATGG + Intergenic
1174306031 20:49614937-49614959 AAACAAAGGGAGAACGGGGAGGG + Intergenic
1177235006 21:18377388-18377410 CATCAAACTCAGAAGGGGGAAGG + Intronic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1178750404 21:35297230-35297252 CATGAAAGGGACAACATGGATGG - Intronic
1180214798 21:46317237-46317259 CAAGAACGGCAGAACGTGGAAGG - Exonic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184923750 22:47623551-47623573 CATCACAGGCAGAAAGCGCACGG + Intergenic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
950840599 3:15964815-15964837 CATCCAAGGAAGAAAGAGGAAGG - Intergenic
952273036 3:31851380-31851402 CATCAAAGGTAGATGATGGAGGG - Intronic
953957415 3:47242353-47242375 CATCAAAAAAAGAACATGGAGGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956675631 3:71729403-71729425 CAATAAAGGCAGAACATGGGAGG + Intronic
958525328 3:95251504-95251526 CATCAGAGTCAAAACGTTGACGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964931084 3:162024063-162024085 CATCATAGACAGAACTTGTATGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967270250 3:187726921-187726943 CACCAAAGTCAGCACGAGGAAGG + Intronic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968298552 3:197595723-197595745 CATCACAGGGAGGAAGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969544422 4:7815588-7815610 CAGCAAAGGCAGAGCTTGAATGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970485612 4:16521688-16521710 GAACAAAGGCAGAAGGTGTAGGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
973979572 4:56296706-56296728 CAACACAGGCAGCACTTGGAGGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978132605 4:105217160-105217182 TTTCAAAGGCATAACTTGGATGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979757208 4:124356118-124356140 CATCAAAGGCAGTACTAAGAGGG + Intergenic
981505690 4:145496816-145496838 CTTCAAAGGGAGAAAGTGGTAGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982145286 4:152381844-152381866 CATGAAAGGCAAAAAGTTGATGG - Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983916373 4:173296466-173296488 AATCAAAGGCAGAACTTTGGAGG + Intronic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985167403 4:187111567-187111589 CATCAAAGGCAGTTCCTGGCTGG + Intergenic
987207709 5:15644507-15644529 CATCAAAGGTGGAACGTGGGTGG + Intronic
988519371 5:31931936-31931958 CATTAATGGCAGAAGTTGGAAGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
995656381 5:114431728-114431750 CACCAAAAGCAGTACTTGGAAGG - Intronic
996434774 5:123422669-123422691 CATCCAAAGCAGCACGTCGATGG - Intronic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
999218804 5:149958252-149958274 AATCAAAGGCAGCGGGTGGAGGG - Intergenic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1007694001 6:43720109-43720131 CATCAAAGGCAGAGCGCAGAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1013441192 6:110171418-110171440 CATCAAAAGCAGTGCTTGGAGGG + Intronic
1015680265 6:135799657-135799679 CATTAATGGCAGAAGGTGAAGGG - Intergenic
1018234333 6:161708649-161708671 CATAAAATGCAGAACATAGAAGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021305261 7:19023931-19023953 AAGTAAAAGCAGAACGTGGATGG + Intronic
1021306058 7:19034033-19034055 GAGCAAAGGCAGTACCTGGAAGG + Intronic
1021385809 7:20028345-20028367 AATCAATGGCAGAAGGTGAAGGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1024356896 7:48422813-48422835 CATCAAAGGGGGATCGAGGAAGG + Intronic
1024792231 7:52979807-52979829 CAACAAAGGAAAAACGTGTAGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1028850751 7:95534597-95534619 CATCGAGGGCAGAGAGTGGAGGG - Intronic
1029615062 7:101651102-101651124 GGTCAAAGGCAGAACATGGTGGG + Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030570459 7:111215506-111215528 CATAACAGGCAAAACATGGAAGG + Intronic
1031064997 7:117095228-117095250 CATGAGAGCCAGAACGTGGCTGG + Intronic
1031222288 7:118984135-118984157 CATCAAAAGCAGTACTTAGAGGG + Intergenic
1032258201 7:130313659-130313681 CATCAAAGGAATGACGTGGATGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034291680 7:149937594-149937616 AATCAAAGACAGACCGTGGGTGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040627671 8:49169618-49169640 CATCAAAAGCAGTACTTAGAAGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042769419 8:72363276-72363298 CATCAAAGGCAGAACCATGTGGG + Intergenic
1044855417 8:96470114-96470136 CATCAAAGGTGGAACTTGGGAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045239457 8:100386437-100386459 CATCAGATACAGAAAGTGGAAGG - Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047193285 8:122698321-122698343 CATCAAGGGCAGAACATCAAAGG + Intergenic
1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG + Intergenic
1048104714 8:131395451-131395473 CATCACAGGCAGAACGGAGAGGG - Intergenic
1049653319 8:143786782-143786804 CATACAAGGGAGAACTTGGAGGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1052063863 9:23992699-23992721 CATCAAAGACAAAAGGTAGATGG + Intergenic
1053076761 9:35140294-35140316 CATCAAAAGTATAAAGTGGAAGG + Intergenic
1053426691 9:38014778-38014800 CAGCAAAGGCAGAGCCTAGAAGG + Intronic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055403005 9:75944596-75944618 CAACAAAGACAGAAGGTGCAGGG - Intronic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1056802974 9:89706952-89706974 CATGAAAGGCAGAGCTGGGAGGG + Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1059208880 9:112492509-112492531 CATGAAAGGCAGTAGGTAGAGGG - Intronic
1185527512 X:791079-791101 CTTCGAAGGCAGACCGGGGAGGG - Intergenic
1187263676 X:17710782-17710804 CAGTAAAGGCAGAATGTGCATGG + Intronic
1187363682 X:18649924-18649946 CATCAAATGCTCAAAGTGGAGGG - Intronic
1188089189 X:25941295-25941317 GATGAAATGCAGAAGGTGGATGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188928396 X:36074790-36074812 CATCAGAGGCTGAAGGTTGAGGG - Intronic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189438959 X:41017480-41017502 AATCAAAGGAAGAATGTGGGAGG - Intergenic
1189614546 X:42769893-42769915 CATTAAAGGAATGACGTGGATGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1194090056 X:89574810-89574832 CATGCAAGGCTGAACCTGGAGGG + Intergenic
1199491783 X:148407949-148407971 TATCAAAGGGAGAATGTAGATGG - Intergenic
1200829871 Y:7679496-7679518 CATAAACGGCAGAAAGTTGAAGG + Intergenic