ID: 1101991057

View in Genome Browser
Species Human (GRCh38)
Location 12:109485477-109485499
Sequence GCAGCTTGCCCAATATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 1, 2: 11, 3: 74, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101991051_1101991057 19 Left 1101991051 12:109485435-109485457 CCTCATCTTACAGAGAAGGAAAC 0: 1
1: 36
2: 454
3: 2108
4: 6459
Right 1101991057 12:109485477-109485499 GCAGCTTGCCCAATATCACATGG 0: 1
1: 1
2: 11
3: 74
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101991057 Original CRISPR GCAGCTTGCCCAATATCACA TGG Intronic
900713593 1:4130056-4130078 GCAGCTGCTGCAATATCACAGGG + Intergenic
902477579 1:16696469-16696491 GCATCTTGCCCACCATCACCTGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903451235 1:23455138-23455160 GCAGCTTGCCCGAGGTCACACGG - Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
904703856 1:32375900-32375922 GTAACTTGCCCAAGTTCACATGG - Intronic
904747104 1:32718073-32718095 GCAGCTTGCCTAGGGTCACATGG + Intergenic
905597789 1:39223381-39223403 GCAGCTTGCCCAAGATCACAAGG - Intronic
905835463 1:41116410-41116432 GGAGCTTGCTCAAGATCACGTGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
907069901 1:51524975-51524997 GAAGCTTGCCCTAAATCACAAGG + Intergenic
907262950 1:53235305-53235327 GGAACTTGCCCAAGGTCACATGG + Intronic
907492390 1:54816373-54816395 GCAACTTGCCCAAGGTAACACGG - Intronic
907762534 1:57375553-57375575 GCAGTAGGCCCAACATCACAGGG + Intronic
907798421 1:57740379-57740401 GTACCTTGCCCAAGAACACATGG - Intronic
907917900 1:58887586-58887608 GCAGTTTCCTCAGTATCACAGGG + Intergenic
908398885 1:63751618-63751640 GTAACTTGCCCAAAAGCACATGG - Intergenic
908478700 1:64515033-64515055 GCAGTATGACCAAAATCACATGG - Intronic
908653283 1:66359957-66359979 GCAACTTGCCCAAGCTCAGAGGG - Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
913120558 1:115736759-115736781 TTAACTTGCCCATTATCACATGG - Intronic
913205959 1:116538994-116539016 GTAACTTGCCCAATGTCAAATGG - Intronic
914854505 1:151341441-151341463 TCAGCCTCCCCAAAATCACATGG - Exonic
915865287 1:159493031-159493053 AAAGCTTGCCCAAAATCACACGG + Intergenic
916592026 1:166201096-166201118 GTGGCTTGCCCAAGTTCACATGG - Intergenic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
918390334 1:184052887-184052909 GCAACTTGTCCCAAATCACAAGG - Intronic
919979688 1:202635150-202635172 GCAACTTGCCCAAAGTCCCATGG + Intronic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
920749570 1:208660979-208661001 GCAGTTTGTCCAAGATCACTGGG + Intergenic
922070992 1:222193370-222193392 GCAGGTTGCCCATTCTCCCATGG + Intergenic
922084312 1:222331360-222331382 GTAACTTGTCCAAGATCACAAGG + Intergenic
922626422 1:227049534-227049556 TCAGCTTGTCAAATTTCACATGG - Intronic
923196339 1:231671772-231671794 GTAGCTTGCCCAACCTCACATGG - Intronic
924012113 1:239676679-239676701 GGAGCTTGCCCAATACCACAGGG - Intronic
924447525 1:244147517-244147539 GAAGTTTGCCCCAAATCACAAGG - Intergenic
1063689485 10:8272712-8272734 GCACCTTGCCCAATGTCTCCTGG - Intergenic
1063735069 10:8743763-8743785 GAAACTTGCCCAAGGTCACATGG - Intergenic
1064046471 10:12021145-12021167 AGGGCTTGCCCAATATAACATGG - Intronic
1064084510 10:12335144-12335166 AGAACTTGCCCAAGATCACAAGG - Intergenic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1066415395 10:35216604-35216626 GTAGCTTGCCAAAGGTCACATGG + Intergenic
1066634891 10:37490594-37490616 AGAACTTGCCCAAGATCACATGG - Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1067701846 10:48579517-48579539 GCAGCTTGCACAAGCTCAAATGG - Intronic
1068797305 10:61097744-61097766 GCAGCTTTACCAATATCTCTGGG + Intergenic
1069341982 10:67421515-67421537 GCACCTTTCCCATTGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070841148 10:79488701-79488723 GCAGATTACCTAATATCACTGGG - Intergenic
1070975110 10:80600160-80600182 TCAGGTTGCCCAAGATCACACGG + Intronic
1071277157 10:84065777-84065799 GCAACTTGCCTAAAATCACAGGG + Intergenic
1071280574 10:84098892-84098914 ATAACTTGCCCAACATCACATGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1073265287 10:102224469-102224491 GTAACTTGCCTAAAATCACATGG + Intergenic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1073503085 10:103959871-103959893 GTGACTTGCCCAATGTCACAGGG + Intergenic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1075050266 10:119178444-119178466 GGCGCTTGCCCAAGATCACAGGG + Intronic
1075211407 10:120494360-120494382 GCACCTTGCCCAAGGTCACGTGG + Intronic
1075548457 10:123373981-123374003 ACAATTTGCCCAAGATCACAAGG + Intergenic
1076310366 10:129501985-129502007 ACAGCTGTCCCAGTATCACATGG - Intronic
1077146893 11:1050475-1050497 GCAGCCTGCCCAAGGTCACCGGG + Intergenic
1077856330 11:6129823-6129845 GAAACTTGCCCAAGGTCACAGGG + Intergenic
1078196393 11:9140320-9140342 GTAGCTTGTCCAAGATCACATGG + Intronic
1078362604 11:10680694-10680716 ACAGCTTGCCCAAGGTCACATGG - Intronic
1078374313 11:10780639-10780661 GTAACTTGCCCAAAGTCACATGG - Intergenic
1078860030 11:15238522-15238544 GTATCTTGCCCAGTGTCACATGG - Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1079531647 11:21461709-21461731 GCATCTTGCCTAAGCTCACAAGG + Intronic
1081449868 11:43160919-43160941 ACATCATGCCCAATATCGCAGGG + Intergenic
1081451149 11:43171946-43171968 ACACCATGCCCAATATCGCAAGG + Intergenic
1081915846 11:46729636-46729658 GCAACTTGCTCAAAGTCACATGG - Intronic
1082656591 11:55865307-55865329 GTAGGTTGTCCAATATCAAAGGG + Intergenic
1082802764 11:57426784-57426806 GGAACTTGCCCAAGGTCACAGGG + Intronic
1082997976 11:59267913-59267935 GCATCTTGCCCTATAACAGAAGG + Intergenic
1083488730 11:62999573-62999595 GCACCTTGACCAAGGTCACAGGG + Intronic
1083598775 11:63933410-63933432 GCAGCTTGCCTAAAGTCACAAGG + Intergenic
1084995500 11:72973519-72973541 GCAAGTTGCATAATATCACAGGG + Intronic
1085226127 11:74922771-74922793 GTAATTTGCCTAATATCACATGG - Intronic
1085380567 11:76113724-76113746 GCATCCTGCCCAAAGTCACAGGG - Intronic
1085626662 11:78079149-78079171 GCAGCTTGCCCAAGGTCATATGG - Intronic
1086916566 11:92536430-92536452 GTCACTTGCCCAACATCACATGG - Intronic
1086929054 11:92672330-92672352 GCAGCCTGCCCATTGTCAGATGG + Intronic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1087856574 11:103098991-103099013 GCAACTTGTGCAATGTCACAGGG - Intergenic
1088455258 11:110026746-110026768 GAAACTTGCCCAAGGTCACAAGG - Intergenic
1088535316 11:110853978-110854000 GTACCTTGTCCAACATCACATGG + Intergenic
1088807721 11:113367291-113367313 GCAACTTGCCCAAAGTCACATGG - Intronic
1089185010 11:116608812-116608834 GCAGCTTGCCCAGGGTCAAATGG + Intergenic
1089972894 11:122708764-122708786 GGAACTTGCCCCATATTACATGG - Intronic
1090422033 11:126582015-126582037 GCAGCCTGCCCAGGGTCACACGG + Intronic
1090804270 11:130192958-130192980 GTAACTTGCCCAACATCTCATGG - Intronic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091171217 11:133521258-133521280 ACTGCTTGCCCAAGATCACTTGG + Intronic
1091281672 11:134385051-134385073 GCAGCTTGCTCAAGGGCACAGGG - Intronic
1091358282 11:134955025-134955047 GCAATTTGCCCAAATTCACACGG - Intergenic
1091780909 12:3214071-3214093 GCAGTTTGCCCAGGATCACACGG - Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092124461 12:6065690-6065712 GGAGGCTGCCCAATAGCACAGGG + Intronic
1095599317 12:43997130-43997152 CCAGCTTACCCAATCTCTCAGGG - Intronic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096614409 12:52823696-52823718 GGAGCTTGTCCAACGTCACATGG - Intronic
1098229407 12:68357730-68357752 GCAGCTTACCCAAGATCACATGG - Intergenic
1098285104 12:68898774-68898796 GCAATTTGCCCAATACCACATGG - Intronic
1098394082 12:69999968-69999990 GTACATTACCCAATATCACATGG + Intergenic
1098783096 12:74713329-74713351 GCAACTTTGCCAATAACACATGG - Intergenic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1099776769 12:87143308-87143330 GAAACTTGCCCAATTTCACAAGG + Intergenic
1100507805 12:95237201-95237223 GGAACTTGCCCAAGGTCACAAGG - Intronic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1101437175 12:104673762-104673784 GGAACTTGCCCAAGGTCACACGG - Intronic
1101714470 12:107298408-107298430 GGAGCTTGCCCAAGGACACATGG - Intergenic
1101991057 12:109485477-109485499 GCAGCTTGCCCAATATCACATGG + Intronic
1102075804 12:110059030-110059052 GAAGCTTGTCCAAGGTCACATGG + Exonic
1102552747 12:113703475-113703497 GCAACTGGCCCAAGGTCACAAGG - Intergenic
1102947328 12:117000958-117000980 GTAGCTTGCCCCAAATTACATGG - Intronic
1103036782 12:117663282-117663304 GCAGTTGGCCCAAGGTCACAAGG - Intronic
1103231805 12:119337395-119337417 GCAGCTTGCCCAAGACCACAGGG - Intronic
1103253175 12:119518459-119518481 GCAACTTGCCCAACATAACCCGG - Intronic
1103466646 12:121147224-121147246 GAAGCTTGTCCAAGGTCACATGG - Intronic
1104044877 12:125154640-125154662 GGAACTTGCCCAAGATCCCATGG + Intergenic
1104294266 12:127497332-127497354 GAAGCTTGCCCAAGAGCAGAGGG - Intergenic
1105531373 13:21223751-21223773 ACATCTTGCCCAAGGTCACATGG - Intergenic
1107614362 13:42149122-42149144 CCAGCCTGGGCAATATCACAAGG - Intronic
1110136293 13:72071443-72071465 GTAACTTGCCCAAGCTCACACGG + Intergenic
1111741622 13:92212270-92212292 GCAGTTTGCCCAGGATTACAGGG + Intronic
1113637226 13:111927966-111927988 GCAACTTTCCCAAGATCACACGG + Intergenic
1114866995 14:26608024-26608046 ACAGCTTGTCCAAGGTCACATGG - Intergenic
1115433538 14:33348168-33348190 GTAACTTGCCCCATATCCCATGG + Intronic
1118412561 14:65496932-65496954 GTAACTTGCCCAATGTCACAGGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1119934719 14:78581126-78581148 GCTACTTGACCAAAATCACAAGG + Intronic
1120290272 14:82560787-82560809 GCAGCATGCCTAAAATCTCAGGG - Intergenic
1120531793 14:85640928-85640950 GCAACTTGCCCAAGGTCACGGGG - Exonic
1120886708 14:89457472-89457494 GTAGCTTGCCCAAGGTCATACGG - Intronic
1120913633 14:89690429-89690451 GTAGGTTGCCCAAGGTCACATGG + Intergenic
1121323613 14:93007138-93007160 GCTGCCTGCCCAAGGTCACACGG + Intronic
1125286640 15:38100279-38100301 CCAGCTTGTCAAAGATCACATGG - Intergenic
1126733387 15:51707620-51707642 GCAACTTGCTCAAGATCTCATGG + Intronic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1127360770 15:58243171-58243193 GCAACTAGCCCAAAATGACAAGG + Intronic
1127489971 15:59453277-59453299 GCAACTGGCCCAACATCACATGG - Intronic
1127574226 15:60274241-60274263 GCACCTTGCCAATAATCACATGG + Intergenic
1127669019 15:61176660-61176682 GCAGCTTGCCCATGTTCATATGG - Intronic
1127759358 15:62122593-62122615 GTAGCTTACCCAATATCTTAAGG - Intergenic
1127785681 15:62352823-62352845 GTAATTTGCCCAAGATCACATGG - Intergenic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1128741269 15:70085480-70085502 GGAGTTTGCCCAATATCCCTGGG + Intronic
1130231321 15:82099474-82099496 GCAACTTGCCCAGTATCACAGGG - Intergenic
1132555081 16:568771-568793 GCAGCTGGCCCAGGATCTCAAGG - Exonic
1134035905 16:11031301-11031323 GGAGCTTGCCCACTGTCCCATGG - Intronic
1134637313 16:15802366-15802388 GCAACTTGCCCAAGGTCACTAGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134830058 16:17315744-17315766 GCAACTTGCCCAAGGTCACCTGG + Intronic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136193763 16:28636530-28636552 GCACTTTGTCCAATGTCACACGG - Intergenic
1137983825 16:53091295-53091317 GCAGCTTGCCCAAGGTCACCCGG - Intronic
1138558788 16:57787964-57787986 GCTGCTTCCCCATTATCACCAGG + Intronic
1138644006 16:58409595-58409617 GCAGCTTTCCCTAGACCACAAGG - Intergenic
1139963120 16:70729306-70729328 ACAGCCTCCCCACTATCACAGGG + Intronic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140649165 16:77067624-77067646 GCAACATTCTCAATATCACAAGG + Intergenic
1140713442 16:77699910-77699932 GTAGCTTGCCCAAAGTCACACGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1142616833 17:1141406-1141428 GTAGCTTGCCCAAGGTCACATGG - Intronic
1142673519 17:1498950-1498972 GCACCTTTCCCAAAGTCACAAGG + Intronic
1142754355 17:2007052-2007074 GCAGCTTGCCCAGCATCATACGG - Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1145088799 17:19968737-19968759 GTAACTTGTCCAAGATCACATGG - Intronic
1145770918 17:27492499-27492521 GCAGCTTGTCCAAGGTCACATGG - Intronic
1146520031 17:33519186-33519208 GTAGCTTACCCAAGGTCACACGG + Intronic
1146931519 17:36781363-36781385 GCAACTTGCCCAAAGTCACACGG - Intergenic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147499890 17:40952914-40952936 GTAACTTGCCCAAGATCTCATGG + Intergenic
1147638357 17:41978102-41978124 GTAACTTGCCCACGATCACATGG + Intronic
1147789540 17:43004948-43004970 GAAACTTGCCCAAGGTCACAGGG - Intergenic
1147833662 17:43314961-43314983 GCAGCTTGCCCAAGACCACAGGG - Intergenic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1148546614 17:48524172-48524194 GCAACTTGCCCAAGGCCACAGGG + Intergenic
1149005802 17:51803985-51804007 GCAACTTGGTCAAGATCACACGG - Intronic
1149258438 17:54853302-54853324 ACAAATTGCCCAAAATCACATGG + Intergenic
1149559859 17:57600935-57600957 GCAGTTTGCCCAAGGTCACATGG + Intronic
1149609529 17:57949938-57949960 ATAACTTGCCCAAGATCACATGG - Intronic
1149982115 17:61318986-61319008 TGAGCTTGCTCAAGATCACATGG - Intronic
1150439783 17:65181741-65181763 AGAGCTTGCCCAAGATCACATGG - Intronic
1152381034 17:79942340-79942362 GCAGCTTGCCCAGGGCCACACGG - Intronic
1154496655 18:14966213-14966235 GCAATTTGCCCAAATTCACATGG + Intergenic
1157203316 18:45677486-45677508 GCAACTTGCCCAGGATTACATGG - Intronic
1157309300 18:46540166-46540188 GTAACTTGCCCAAAGTCACATGG + Intronic
1157511123 18:48275536-48275558 GCGACTTGCCCTAAATCACAGGG + Intronic
1158308597 18:56134187-56134209 GTGGCTTGCTCAAAATCACATGG + Intergenic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1166469760 19:43069622-43069644 CCAGCTTTCCCAATATCATTTGG - Intronic
1166480894 19:43173140-43173162 CCAGCTTTCCCAATATCATTTGG - Intronic
1166887483 19:45971062-45971084 ACCGCTTGCCCAAGGTCACACGG - Intronic
1202711599 1_KI270714v1_random:22295-22317 GCATCTTGCCCACCATCACCTGG + Intergenic
926729267 2:16023010-16023032 GCAACTTGCCCAAGTTCACATGG - Intergenic
927187815 2:20494821-20494843 GCAGCTTGTCCAAGGTCACAGGG + Intergenic
927265237 2:21139862-21139884 GCAGTCTGCCCAATCTCATAAGG - Exonic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928540871 2:32282401-32282423 GTAGCTTGCCCAAGATCACATGG - Intronic
928998155 2:37318420-37318442 GCAACTTGCCCAGCAGCACATGG + Intronic
929490048 2:42388020-42388042 GTGGCTTGCCCAATGTCACATGG - Intronic
929874699 2:45786845-45786867 GTAACTTGCACAAAATCACATGG + Intronic
930333332 2:50014690-50014712 ATAACTTGCCCAATGTCACATGG + Intronic
930537809 2:52666240-52666262 CCTGTATGCCCAATATCACATGG + Intergenic
930737846 2:54797793-54797815 GTAACTTGCCCAAGATTACATGG - Intronic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932094589 2:68836478-68836500 GCAGCTTCCACAGTAACACAAGG - Intergenic
933029577 2:77311464-77311486 GAAGCTTGCCTAATTTCCCACGG - Intronic
934152541 2:89161338-89161360 GCAGCTCTCAAAATATCACAGGG + Intergenic
934214704 2:90020577-90020599 GCAGCTCTCAAAATATCACAGGG - Intergenic
934930732 2:98420674-98420696 GCAGCATGCCCAAAAGCTCAAGG + Intergenic
937034588 2:118770207-118770229 GCAACTTGCCCAAGGTCGCATGG - Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
939463151 2:142523634-142523656 GTAGCTTGCCAAATATCTCAAGG - Intergenic
940006787 2:149015747-149015769 GTAACTTGCCCAATGTCACATGG - Intronic
940130770 2:150378934-150378956 GAAGCATGTCCAAGATCACATGG - Intergenic
940259846 2:151768136-151768158 GCAGCTTTCCCAGGGTCACATGG - Intergenic
942157813 2:173149594-173149616 GAACCTTGCTCAATAGCACAGGG + Intronic
944494971 2:200297719-200297741 GCAATTTGCCCCAAATCACAGGG - Intergenic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945622492 2:212158179-212158201 GCAACTTGCCCAAAGTCACATGG + Intronic
945674026 2:212833414-212833436 GCTGCCTGACCACTATCACACGG + Intergenic
948135250 2:235631625-235631647 CCAACTTGCCCAGAATCACACGG - Intronic
948853026 2:240717647-240717669 GCAGCCTGCCCAAGGGCACACGG + Intronic
948934666 2:241155317-241155339 GCAGCTTGTCCAAGGGCACACGG + Intronic
1170258638 20:14376859-14376881 GTAACTTTCCCAATATCACATGG - Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1172822866 20:37753843-37753865 GGAGCTTGCACAAGATTACATGG + Intronic
1173010503 20:39177328-39177350 GCATCTTGCCTAAGATCACTGGG - Intergenic
1173113393 20:40217534-40217556 GTAGCTTACCCAAGGTCACAGGG + Intergenic
1173759409 20:45546621-45546643 GTAACTTGCCCAAGATTACAGGG + Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1174728730 20:52892707-52892729 ACAACTTTCTCAATATCACAGGG - Intergenic
1175603949 20:60297196-60297218 GTAGCTTGTCACATATCACATGG + Intergenic
1175910067 20:62401019-62401041 GCAACTTGCCCAAGATGACATGG + Intronic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1178690184 21:34744010-34744032 GCAACCTGCCCAAAACCACAGGG - Intergenic
1179567267 21:42257143-42257165 GGAACTTGCCCAAGGTCACACGG + Intronic
1181949473 22:26543705-26543727 GCAGCTTGCCCAAGGTTGCATGG + Intronic
1181975918 22:26729583-26729605 GTAGCTTGCTCAAGAGCACACGG + Intergenic
1182094846 22:27619200-27619222 GTAACTTGCCCAAAGTCACAAGG - Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182124684 22:27807914-27807936 GGAGCTTGCCCTAGGTCACACGG + Intergenic
1182481271 22:30610540-30610562 GCACCTTGCCCAATCTCACTTGG - Intronic
1182639539 22:31755476-31755498 GGAGCTTGCCCAAGGTCACCAGG - Intronic
1182782991 22:32882588-32882610 GCAGCCTCTCCAATGTCACACGG + Intronic
1183116650 22:35697527-35697549 ACATTATGCCCAATATCACAGGG - Intergenic
1183117462 22:35702834-35702856 ACATTATGCCCAATATCACAGGG - Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183516373 22:38269092-38269114 GCATCTTGCCCAAGGCCACAGGG + Intronic
1184550586 22:45202397-45202419 CCAGCTTGCCCCAGGTCACAAGG - Intronic
1184684913 22:46091886-46091908 GGGGCTGGCCCAAGATCACACGG - Intronic
950367681 3:12499625-12499647 GTAGCTTGCCCAAGATTACGTGG + Intronic
950683461 3:14601284-14601306 GAGGCTTGTCCAAGATCACAGGG + Intergenic
950839869 3:15957618-15957640 GTAGCTTTCCCAAGGTCACATGG + Intergenic
950968479 3:17163320-17163342 GTAGCTTGGCCAATGTCACAAGG + Intronic
951362301 3:21739652-21739674 CCAGCTTGCCCATCATAACAAGG + Intronic
951993612 3:28702872-28702894 GAAACTTGCCCAAAGTCACATGG - Intergenic
952499214 3:33944020-33944042 GTAACTTGCCCAGTGTCACAAGG - Intergenic
954416340 3:50395305-50395327 GCAGCCTGCCCAAGGTCACATGG + Intronic
955412438 3:58664640-58664662 GCAACTTGCCTAAGGTCACATGG + Intronic
955578621 3:60394430-60394452 GCAACATGCCCAAAATCAAAAGG + Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
956100201 3:65760344-65760366 GAAACTTGCCCAAGGTCACACGG + Intronic
956247670 3:67202685-67202707 GCAGCTAGTCCAAGGTCACAAGG + Intergenic
956737602 3:72250045-72250067 GTACCTTGCCCAAGATCAGATGG - Intergenic
957359819 3:79140395-79140417 GTAACTTGCCCAAAGTCACAGGG - Intronic
958710219 3:97708870-97708892 CCTGCAGGCCCAATATCACATGG - Intronic
959206399 3:103312354-103312376 ATAACTTGCCCAAGATCACAAGG - Intergenic
960701289 3:120441883-120441905 GTAGTTTTCCCAAGATCACATGG + Intronic
960737902 3:120800741-120800763 GTAATTTGCCCAAGATCACATGG + Intergenic
961588217 3:127952990-127953012 GCAACTTGCTCAAAATCACATGG - Intronic
961591714 3:127986205-127986227 TCATCTTGCCCAAGTTCACATGG - Exonic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
962468154 3:135679689-135679711 GCAGGTTGTCCAAGATCACATGG + Intergenic
963297966 3:143567750-143567772 GCAGCTTGCTCATTAACACGTGG - Intronic
963313715 3:143735843-143735865 GTAGCTTGCTCAATGTCACATGG - Intronic
963897098 3:150698654-150698676 GCAACTTGCCCAACATCACAAGG + Intronic
965197411 3:165619284-165619306 GCAGCATGCTCATTCTCACATGG - Intergenic
967412859 3:189184175-189184197 GGAGCTTGCCCAGGGTCACACGG - Intronic
968116205 3:196091976-196091998 GTAACTTGCCCCATGTCACATGG + Intergenic
968126277 3:196162840-196162862 GCAGCTTGCCCAGGGTCACCCGG + Intergenic
968228568 3:196991035-196991057 GTAACTTGCCCAAGATCACTCGG - Intronic
969085117 4:4650783-4650805 GCAGCTTGCTCAAGATAACAAGG + Intergenic
969116844 4:4875611-4875633 GCACCTTTTCCAAGATCACATGG + Intergenic
969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG + Intronic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
970192412 4:13529055-13529077 GCAGCTTATCCAAGATCTCAAGG - Intergenic
970372342 4:15420677-15420699 GCAATTTGCCCAAGGTCACATGG + Intronic
970828588 4:20307818-20307840 GTAACTTGCCCAAGCTCACATGG + Intronic
970913992 4:21311047-21311069 GCAATTTGCCCAAAGTCACAAGG - Intronic
971749767 4:30632096-30632118 GCAGCTTGCCCCATGTGATAAGG + Intergenic
972019335 4:34290540-34290562 GCATTTTGCCCAAGAACACATGG + Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972533361 4:39979667-39979689 GTAGCTTGCCCATTATTAAATGG + Intergenic
972866270 4:43236964-43236986 AAACCTTGCCCAATATCACAAGG - Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973652516 4:53010545-53010567 GCAGCTTGCCCACAAGGACAGGG - Intronic
973797476 4:54442866-54442888 GTAGCTTGCCCAAAGTCACACGG - Intergenic
974261283 4:59527946-59527968 GTAACTTGCCCAGTATTACACGG - Intergenic
976314639 4:83646229-83646251 GTAAATTGCCCAAAATCACACGG - Intergenic
976334334 4:83868288-83868310 ACAACTTGCCCAAGATCACGTGG - Intergenic
976521186 4:86029077-86029099 GCAGATGGACAAATATCACATGG - Intronic
978884928 4:113757545-113757567 GAAACTTGCCCAAAGTCACAAGG + Intronic
979293005 4:118998985-118999007 ATGGCTTGCCCAAGATCACACGG - Intronic
981171773 4:141633545-141633567 ACAGCTTGCCTAAGATCACATGG - Intergenic
981250384 4:142594503-142594525 GCAGCTTGCTCCAAATTACATGG + Intronic
981731152 4:147900435-147900457 GCAGCTTGCCCTTTTTCACTTGG + Intronic
983379104 4:166968572-166968594 CCTGCATGCCCAACATCACATGG - Intronic
983514020 4:168638252-168638274 GCATCTTGCCCAAGATCACATGG + Intronic
984880254 4:184404596-184404618 GGAGTTTGCCCAAAATCACATGG + Intronic
986396894 5:7339984-7340006 GCAGGGTGCCCAATACCACCTGG + Intergenic
986987350 5:13514611-13514633 CCTGCTGGCCCAATATCACATGG - Intergenic
987266358 5:16259543-16259565 GTACCTTGGCCAATATTACACGG - Intergenic
987526229 5:19053427-19053449 GCACCTTGACCCATATCCCAGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991139626 5:63225066-63225088 GCAGTTTTCCCAATTTTACAAGG + Intergenic
991206541 5:64056231-64056253 GTAACTTGTCCAAGATCACACGG - Intergenic
992028611 5:72697348-72697370 TCAGCCAGCACAATATCACAGGG + Intergenic
992182722 5:74213807-74213829 GTAGCTTGTCCAAGGTCACATGG + Intergenic
992997103 5:82344864-82344886 GCAGCTTGACCATTAACACTTGG - Intronic
993106565 5:83606824-83606846 GCAGCTTCCAGCATATCACAGGG + Intergenic
993456487 5:88132956-88132978 GTAACTTGCCCAAGATCACTTGG - Intergenic
993570950 5:89538312-89538334 GCAACTTGACCAAGATCACAAGG + Intergenic
993925692 5:93863142-93863164 TCTGCTTGCCCTATATAACATGG - Intronic
995448805 5:112277587-112277609 ACAACTTGCCTAAAATCACAGGG + Intronic
996032738 5:118724069-118724091 GTGGCTTGCCCAAGATCACTTGG - Intergenic
996786155 5:127238578-127238600 GTAACTTGCCCAAAGTCACACGG + Intergenic
997607194 5:135183599-135183621 GCAACTTACCCCAGATCACACGG - Intronic
998885120 5:146686088-146686110 GAAGTTTGCCCAAAATCTCATGG - Intronic
999182530 5:149680352-149680374 GCAGCTTGCCCTAGGTCACGCGG + Intergenic
999233936 5:150079289-150079311 GCAGCTAGCCCAATGCCACTGGG - Intronic
999267217 5:150274717-150274739 GTAGATTGCCCAAGGTCACATGG + Intronic
1000119171 5:158180162-158180184 GCAACTTGCCCAAGGCCACACGG - Intergenic
1001245355 5:170102001-170102023 GAAACTTGGCCAAGATCACAAGG + Intergenic
1002163548 5:177331372-177331394 ACAGCTTGCCCAGTGTCACCTGG - Intergenic
1002372495 5:178766643-178766665 GGAGCTTGCCCAAGGTCACATGG - Intergenic
1002449662 5:179311395-179311417 GCAGCATGCCAAGAATCACAGGG + Intronic
1003044066 6:2716731-2716753 ATAGCTTGTCCAAGATCACATGG - Intronic
1003916681 6:10793351-10793373 GTAGCCTGCCCAAGATCTCACGG + Intronic
1005245346 6:23877863-23877885 ACAACTTGTCCAATATCATATGG - Intergenic
1005899311 6:30204197-30204219 GCAACTTGCCCAAGAGCACATGG + Intronic
1006550049 6:34815006-34815028 GCAGTTTGCCCTAGATGACAGGG - Intronic
1007243843 6:40445804-40445826 GCAACTTGCCCAAGACCACAGGG - Intronic
1007946050 6:45827999-45828021 GCAGCTTACCCAATATCATGTGG + Intergenic
1008012585 6:46484413-46484435 GAAGCTTGCCCAAAAGCAGAAGG + Intronic
1008142854 6:47852103-47852125 GCAACTTGCCAAATATTCCATGG + Intergenic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1010206720 6:73328924-73328946 GCAGTTTGCCCCATACCAAATGG - Intergenic
1010731632 6:79397383-79397405 GCAACTTGCTCGATATCTCATGG + Intergenic
1010823636 6:80446544-80446566 GCAGCCTGCCCAGTCTCAGAAGG + Intergenic
1011514440 6:88137188-88137210 GTATCTTGCCCAAGTTCACATGG - Intergenic
1011554476 6:88560334-88560356 GTAGCCTGCCCAGGATCACATGG + Intergenic
1012398099 6:98822954-98822976 ATATCTTGCCCCATATCACATGG - Intergenic
1013581329 6:111537351-111537373 GTAACTTGCCTAAGATCACATGG + Intergenic
1014181613 6:118390557-118390579 GCAGCTTGCCCAAGTTGAAAGGG + Intergenic
1014760874 6:125355579-125355601 GCAGATTCCCCACTTTCACACGG - Intergenic
1015837433 6:137435808-137435830 CCAGCCTGACCAATATAACATGG + Intergenic
1017155309 6:151317511-151317533 GAAGCTTGCCAAACATCACTGGG + Intronic
1017676569 6:156820326-156820348 ACAGCTTCCTCAATACCACATGG - Intronic
1021157392 7:17227899-17227921 GTAACTTGCCCAATGTCACATGG + Intergenic
1021715119 7:23454641-23454663 TCAGTTTGCACAAGATCACAGGG + Intronic
1023506751 7:40907628-40907650 GTATATTGCCTAATATCACATGG + Intergenic
1024291131 7:47805191-47805213 GAAACTTGCCCAATGGCACATGG + Intronic
1024587401 7:50853905-50853927 GCAGCTTTACAAATATCAGAAGG - Intergenic
1027206878 7:76107441-76107463 GCAGCCTGCCCAAAATCACATGG + Intergenic
1027658564 7:80961620-80961642 ACAGCTTGCCCGAGATCAAAAGG - Intergenic
1028234607 7:88345838-88345860 GCATCTTGCCCAAGGACACACGG - Intergenic
1028921187 7:96312204-96312226 ATAACTTGCCCAAGATCACATGG - Intronic
1029035396 7:97514655-97514677 GCACCTTTCCCACTATAACATGG - Intergenic
1030271477 7:107673408-107673430 GTACCTTGATCAATATCACAGGG - Intronic
1032087026 7:128889852-128889874 GTAACTTGCCCAAGACCACACGG + Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1032835634 7:135670292-135670314 CCTGCTTCCCCCATATCACATGG - Intronic
1033506648 7:142009389-142009411 GTAACTTGCACAATATGACAGGG - Intronic
1034500801 7:151449212-151449234 GTAGCTTGCACAAGGTCACAGGG + Intergenic
1034731145 7:153388570-153388592 GTAACTTGCCCAATATCACATGG + Intergenic
1039236105 8:35504244-35504266 ACAGCTTGCCTAAGGTCACACGG - Intronic
1039756197 8:40525603-40525625 GAAGCTTGCCCGAGATCTCAAGG + Intergenic
1042790875 8:72604445-72604467 GTAACTTGTCCAAAATCACATGG - Intronic
1042998064 8:74722841-74722863 GCATCTTGCCCAAGATTACACGG + Intronic
1044566275 8:93663909-93663931 ACAGTTTGCATAATATCACAGGG - Intergenic
1044759710 8:95505316-95505338 GCAACTTGGCCAAGGTCACATGG + Intergenic
1047199521 8:122753487-122753509 GTAACTTACCCAATGTCACACGG + Intergenic
1047325144 8:123828810-123828832 GCACTTTGCCCAAGGTCACATGG - Intergenic
1047429656 8:124780274-124780296 GCAACTTGCCCAATCGCACAGGG - Intergenic
1047904968 8:129463152-129463174 GTAACTTGCCCAAAGTCACAGGG + Intergenic
1050870228 9:10558539-10558561 GTAGCTTGCCCAAGGCCACATGG - Intronic
1051147773 9:14047153-14047175 ATGACTTGCCCAATATCACATGG + Intergenic
1051441111 9:17084162-17084184 GTGACTTGCCCAATATCATATGG - Intergenic
1052691162 9:31818515-31818537 GCAACTTGCCAAAGGTCACATGG - Intergenic
1053173114 9:35904955-35904977 GGGGTTTGCCCAACATCACAGGG + Intergenic
1054970753 9:71083360-71083382 GCAACTTGCCCAAGGTTACAAGG + Intronic
1054991372 9:71330988-71331010 GCAGCTTGCCCAAGCTCTCATGG - Intronic
1055424339 9:76178440-76178462 GTGGCTTGCCCAGTATCACATGG - Intronic
1055790100 9:79914495-79914517 TCAGCTTTCCAAAGATCACAGGG + Intergenic
1056140167 9:83669913-83669935 ATAACTTGCCCAAGATCACATGG - Intronic
1056559708 9:87719352-87719374 GGAGCTTGCCCAAGGGCACAGGG - Intergenic
1056566410 9:87776722-87776744 GGAGCTTGCCCAAGGGCACAGGG + Intergenic
1056867934 9:90246415-90246437 CCAGCTTGCACAATTGCACAGGG + Intergenic
1058239695 9:102541426-102541448 GCAGCTGGCAGAATACCACATGG + Intergenic
1059384021 9:113950221-113950243 GTAGCTTGCCCAATGCCATAAGG + Intronic
1059754090 9:117276271-117276293 GTAGCTAGCCCAAGATCACACGG + Intronic
1060398940 9:123336400-123336422 AAACCTTGCCCAAGATCACAGGG + Intergenic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061276480 9:129571788-129571810 GCAGCTTGCCCAAGGACCCAGGG - Intergenic
1062026037 9:134341251-134341273 GCTGCTTGCCCAATATCATGTGG + Intronic
1186968740 X:14816864-14816886 GAAACTTGCCCAAAGTCACAGGG - Intergenic
1187552743 X:20322356-20322378 GTTACTTGCCCAATATCATACGG - Intergenic
1187927123 X:24260700-24260722 CCAGCTTCCCCATTAACACAGGG - Intergenic
1188916897 X:35922465-35922487 GCAGTTTGACCAAAAGCACATGG + Intronic
1189588805 X:42489931-42489953 GAAACTTGCCCAAAGTCACACGG - Intergenic
1189942404 X:46138364-46138386 ACAGTTTACCCAAAATCACATGG + Intergenic
1190261570 X:48801039-48801061 GCAACTTGCCCAAAGTCACATGG + Intergenic
1190638873 X:52463751-52463773 GTATCTTGCCCAACATCACAAGG - Intergenic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1197848418 X:130830018-130830040 GCAACTTGCCTAAGGTCACATGG + Intronic
1198228620 X:134669339-134669361 GTAACTTGCCCAACATCACACGG - Intronic
1199531745 X:148855757-148855779 GTAACTTGACCAAGATCACATGG - Intronic