ID: 1101991801

View in Genome Browser
Species Human (GRCh38)
Location 12:109491880-109491902
Sequence GATACGTTTGGGCCAACCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 27}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101991801_1101991806 9 Left 1101991801 12:109491880-109491902 CCCGGGGTTGGCCCAAACGTATC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1101991806 12:109491912-109491934 AATACCCCTGCCTTGTTTTTTGG 0: 1
1: 0
2: 0
3: 15
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101991801 Original CRISPR GATACGTTTGGGCCAACCCC GGG (reversed) Intronic
901442353 1:9286131-9286153 GCTCTGTTTGGGCCAAGCCCAGG + Intergenic
1101416275 12:104511113-104511135 GAGAAGTTTGGGACAACCCCTGG + Intronic
1101643507 12:106606315-106606337 TATAGTTCTGGGCCAACCCCTGG - Intronic
1101991801 12:109491880-109491902 GATACGTTTGGGCCAACCCCGGG - Intronic
1113093061 13:106635306-106635328 GGTAAAATTGGGCCAACCCCAGG - Intergenic
1113970613 13:114185666-114185688 GAAAAGTTGGGGCCAAGCCCAGG + Intergenic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1140120572 16:72079897-72079919 GATACATTCGGGCCACCCACAGG - Intronic
932501669 2:72187876-72187898 GCAAAGTTGGGGCCAACCCCAGG - Intronic
937203056 2:120218200-120218222 GATATGATTGGGCAAACCTCAGG - Intergenic
937411543 2:121681239-121681261 AATGCATTTGGGCCATCCCCGGG + Intergenic
1172807555 20:37623224-37623246 GAGATGGTTGGGCCAAGCCCAGG + Intergenic
1177204351 21:17994540-17994562 GACACGTGTGGGCCATCCACAGG - Intronic
1182478007 22:30587054-30587076 GAGACGTTTGAGCCAGCCCGCGG - Intronic
990368594 5:55094506-55094528 GATGGGAGTGGGCCAACCCCTGG - Intergenic
991215969 5:64157641-64157663 AATACATTTGGGCCATCCACAGG - Intergenic
991593828 5:68282216-68282238 GAAGCCTTTTGGCCAACCCCTGG - Intronic
991970773 5:72139541-72139563 GCTCCTTTTGGGCCAACCCTTGG + Intronic
995445229 5:112235337-112235359 GAGAAGTTTGGCCCAGCCCCAGG - Intronic
998348192 5:141483163-141483185 GTTACCTTTGGGCCAAGCCAAGG + Intronic
999843076 5:155449787-155449809 AACAGTTTTGGGCCAACCCCAGG - Intergenic
1008857206 6:56103850-56103872 GGTAGGTCTGGGGCAACCCCTGG + Intronic
1029735009 7:102460774-102460796 GATAGGCACGGGCCAACCCCTGG - Intronic
1029821894 7:103154269-103154291 GATGCATTTGGGCCATCCACGGG - Intergenic
1032522085 7:132553176-132553198 GATATGTTTCTGCCAGCCCCAGG + Intronic
1047444697 8:124908960-124908982 AATACATTTGGGCCATCCGCAGG - Intergenic
1057674576 9:97128747-97128769 GATACCCTTGAGCCAACCACTGG - Intergenic
1060110545 9:120903667-120903689 GATAGGTGTGGGCCACCACCAGG + Exonic
1191243995 X:58211581-58211603 GAGACTTTTGGCCAAACCCCAGG + Intergenic
1192364572 X:70460446-70460468 GATACTGTTGGGGGAACCCCAGG + Intronic