ID: 1101991855

View in Genome Browser
Species Human (GRCh38)
Location 12:109492401-109492423
Sequence CCATCGGACAGACCTGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101991855_1101991863 28 Left 1101991855 12:109492401-109492423 CCTAGAGCAGGTCTGTCCGATGG 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1101991863 12:109492452-109492474 CCAAAAGAGGCCAGGCACGGCGG 0: 1
1: 26
2: 332
3: 2396
4: 12559
1101991855_1101991859 15 Left 1101991855 12:109492401-109492423 CCTAGAGCAGGTCTGTCCGATGG 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1101991859 12:109492439-109492461 CACATTTAAAAAGCCAAAAGAGG 0: 1
1: 0
2: 4
3: 75
4: 643
1101991855_1101991860 20 Left 1101991855 12:109492401-109492423 CCTAGAGCAGGTCTGTCCGATGG 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1101991860 12:109492444-109492466 TTAAAAAGCCAAAAGAGGCCAGG 0: 1
1: 2
2: 56
3: 405
4: 2405
1101991855_1101991861 25 Left 1101991855 12:109492401-109492423 CCTAGAGCAGGTCTGTCCGATGG 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1101991861 12:109492449-109492471 AAGCCAAAAGAGGCCAGGCACGG 0: 1
1: 5
2: 87
3: 584
4: 3596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101991855 Original CRISPR CCATCGGACAGACCTGCTCT AGG (reversed) Intronic