ID: 1101992995

View in Genome Browser
Species Human (GRCh38)
Location 12:109502652-109502674
Sequence CAGAAAATAGAGATGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 476}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101992992_1101992995 -2 Left 1101992992 12:109502631-109502653 CCTTACTTCCCTCTAAAGGCACA 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1101992995 12:109502652-109502674 CAGAAAATAGAGATGTAGCCAGG 0: 1
1: 0
2: 3
3: 25
4: 476
1101992990_1101992995 26 Left 1101992990 12:109502603-109502625 CCAGGTGTCAGAACTAGAGGTTG 0: 1
1: 0
2: 0
3: 6
4: 133
Right 1101992995 12:109502652-109502674 CAGAAAATAGAGATGTAGCCAGG 0: 1
1: 0
2: 3
3: 25
4: 476
1101992993_1101992995 -10 Left 1101992993 12:109502639-109502661 CCCTCTAAAGGCACAGAAAATAG 0: 1
1: 0
2: 1
3: 24
4: 300
Right 1101992995 12:109502652-109502674 CAGAAAATAGAGATGTAGCCAGG 0: 1
1: 0
2: 3
3: 25
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101992995 Original CRISPR CAGAAAATAGAGATGTAGCC AGG Intronic
901359680 1:8686452-8686474 ATAAAAATAAAGATGTAGCCGGG + Intronic
901390336 1:8941610-8941632 CTGAAAATACAAAAGTAGCCAGG - Intergenic
901603578 1:10441607-10441629 AAAAAAAAAGAGTTGTAGCCAGG - Intronic
901699372 1:11036207-11036229 CAGAAACTAAAGAAGTCGCCGGG + Intronic
903110297 1:21127148-21127170 CAGAAAATATAAAATTAGCCGGG - Intronic
903460932 1:23520580-23520602 CAAAAAATAAAGAATTAGCCAGG + Intronic
903561455 1:24231206-24231228 CAGAAAATAGGGAGAGAGCCAGG + Intergenic
904095666 1:27975340-27975362 CAAAAAATAAAGAATTAGCCAGG - Intronic
904516188 1:31057240-31057262 CAAAAAATACAAAAGTAGCCGGG + Intronic
904524960 1:31126398-31126420 CAGAAAATACAAAATTAGCCAGG + Intergenic
904534917 1:31192867-31192889 TAAAAAATTTAGATGTAGCCTGG + Intronic
905645190 1:39620384-39620406 CAGAAACTAAAAAAGTAGCCAGG + Intergenic
905737318 1:40338707-40338729 TAGAAATTAGAGATTTGGCCGGG - Intergenic
906437248 1:45806736-45806758 CTAAAAATAGAGAATTAGCCAGG - Intronic
907125089 1:52042781-52042803 CAAAAAATACAGAATTAGCCAGG - Intronic
907350283 1:53824071-53824093 CAAAAAATACAAAAGTAGCCAGG + Intronic
908202239 1:61809680-61809702 CAGAAAATACATTTTTAGCCTGG - Intronic
908223416 1:62032181-62032203 AAGAAAATAGAGAATAAGCCTGG - Intronic
910178288 1:84454511-84454533 CAGAAAAAAGAGAGACAGCCTGG + Intergenic
911105102 1:94123648-94123670 CAGAAAATAGAGTGGTTGGCAGG - Intergenic
911635636 1:100232433-100232455 AACAAAATACAGATGTGGCCAGG - Intronic
911847158 1:102768710-102768732 CAAAAAATAAAAATTTAGCCAGG - Intergenic
912765620 1:112407465-112407487 GAGGAAATAGAGATATAGACGGG - Intronic
913138615 1:115917250-115917272 AAGAAAATAGTGATGTCACCTGG - Intergenic
913600661 1:120418709-120418731 CAAAAAATAGAAAATTAGCCGGG - Intergenic
914086394 1:144457924-144457946 CAAAAAATAGAAAATTAGCCGGG + Intronic
914192290 1:145421875-145421897 CAAAAAATAGAAAATTAGCCGGG + Intergenic
914590196 1:149099819-149099841 CAAAAAATAGAAAATTAGCCGGG + Intronic
914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG + Intergenic
914752508 1:150545087-150545109 CTAAAAATAGAAAAGTAGCCAGG - Intergenic
915206130 1:154271749-154271771 CAAAAAATACAAAAGTAGCCGGG + Intergenic
915682718 1:157596981-157597003 TAGAAAAGTGGGATGTAGCCAGG + Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916669039 1:166995398-166995420 CAAAAAATACAAAAGTAGCCGGG - Intronic
916968472 1:169980804-169980826 CAGAAAGAAGTGATATAGCCGGG + Intronic
917089299 1:171336762-171336784 CAAAAAATAAAAATTTAGCCAGG - Intronic
917235305 1:172885485-172885507 CAGGAAATAGAAATGTAACATGG + Intergenic
917247204 1:173016985-173017007 AAGAAGATAGACATGCAGCCAGG + Intergenic
918558055 1:185829217-185829239 CAGAAAATACAATTGAAGCCTGG + Intronic
918635983 1:186774664-186774686 AAGAAAAGAGATTTGTAGCCAGG - Intergenic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
919998794 1:202778916-202778938 TAGTAAATAGAGATCTAGGCTGG - Intronic
920145904 1:203861048-203861070 CAGAAAATGGAGATACAGGCCGG + Intergenic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
922000311 1:221470833-221470855 AATAAAATAGAGATGTGACCTGG - Intergenic
922653790 1:227363529-227363551 TTCAAAATAGAGATGTGGCCTGG + Intergenic
923896763 1:238278506-238278528 CAAAAAATAGAAAATTAGCCAGG + Intergenic
924098938 1:240583896-240583918 AATAAAATAGAGATGAAGGCTGG - Intronic
924199278 1:241642103-241642125 CAAAAAATAGAAAATTAGCCAGG + Intronic
924359432 1:243221322-243221344 TAGAAAATAAAGATGGAGCTGGG - Intronic
924812301 1:247414063-247414085 AAGAAAATAGAGAAGAAGCCAGG - Intergenic
1063352985 10:5373686-5373708 CAGAAAAGAGGGATGTGGGCAGG - Intronic
1063423444 10:5932876-5932898 CAAAAAATACAGAATTAGCCAGG - Intronic
1063841829 10:10081218-10081240 CTGAAAATACAAAAGTAGCCGGG - Intergenic
1064383615 10:14869588-14869610 TAGAAAATAAATATGTGGCCAGG - Intronic
1064609626 10:17084841-17084863 CAGAATAGCAAGATGTAGCCAGG + Intronic
1064677036 10:17770676-17770698 CAGAAAATTTAAATGTGGCCGGG - Intronic
1066010468 10:31189685-31189707 CAGAAATCAGAGATGCAGCTAGG + Intergenic
1066219870 10:33325212-33325234 TGGAAAATAGAGATGTAGTTTGG + Intronic
1067084757 10:43231870-43231892 CAGAAAGTAGAGAAGAAGCCAGG + Intronic
1067300849 10:45007817-45007839 CTGAACATAGAGATATAACCAGG - Intergenic
1068897747 10:62226075-62226097 TAGAAAATACAGTTGTTGCCGGG - Intronic
1069837473 10:71318543-71318565 CTGAAAATACAAAAGTAGCCGGG - Intergenic
1071169139 10:82842879-82842901 AAGAAAATATAGTTTTAGCCAGG - Intronic
1071590862 10:86871647-86871669 CAGAAAATACAAAATTAGCCAGG + Intronic
1071670304 10:87602931-87602953 CACAAAAGAAAGATGTAGGCTGG - Intergenic
1072896044 10:99367804-99367826 CAGATAAGAGAGATGAAGACAGG + Intronic
1072946613 10:99816260-99816282 CAAAAAACAGAGATGGAGGCCGG - Intronic
1073462375 10:103673400-103673422 CAAAAAATAAAAATCTAGCCAGG + Intronic
1073603819 10:104873165-104873187 CAGAAAATAGAAACATAGCAAGG + Intronic
1075408789 10:122212194-122212216 CAGGAATGAGAGATGTGGCCTGG + Intronic
1077813629 11:5664038-5664060 CTGAAAATACAAATTTAGCCAGG + Exonic
1078568275 11:12435769-12435791 AAAAAAACAGAGATATAGCCAGG - Intronic
1078969981 11:16398033-16398055 CAGAAAATTGCCATGAAGCCTGG - Intronic
1079231585 11:18653822-18653844 CAGAAAATAGTGATATATTCAGG - Intergenic
1079619966 11:22541999-22542021 TAAAATATAGAGATGAAGCCAGG + Intergenic
1080272137 11:30461692-30461714 GAAAAAATAGAGATGTTCCCTGG + Intronic
1081949191 11:47028216-47028238 TAGAAAATAGAGATGTGGCCGGG - Intronic
1082711694 11:56560723-56560745 TTGAAAATAGAGAAGAAGCCAGG - Intergenic
1082868281 11:57919595-57919617 AAGAAAACAGAGATATAGCAAGG + Intergenic
1084921394 11:72473373-72473395 CAAAAAATAAAAATTTAGCCAGG - Intergenic
1085228430 11:74943795-74943817 CAGAAAAAAGAAATGTAGCCTGG - Intronic
1085544243 11:77302116-77302138 AATAAAATAAAGAGGTAGCCTGG - Intergenic
1087071347 11:94084161-94084183 CAGAAAATACAAAATTAGCCAGG + Intronic
1087404443 11:97712664-97712686 CAAAAAATACACATTTAGCCAGG - Intergenic
1087648923 11:100841617-100841639 TGGAAAATAGAGATGAAGACTGG - Intronic
1088042417 11:105403501-105403523 CAGAAAATAAACATTTAGACAGG + Intergenic
1088546817 11:110967546-110967568 CAAAAAATAGAAAATTAGCCGGG - Intergenic
1089348100 11:117804553-117804575 AAGAAAAAAGATACGTAGCCTGG - Intronic
1089512346 11:119007648-119007670 CAAAAAATACAGAAATAGCCAGG - Intronic
1089555433 11:119313560-119313582 CTGAAAATACAAAAGTAGCCGGG - Intronic
1091127278 11:133111711-133111733 CAGAAAATAAAGTTGGTGCCAGG + Intronic
1091521424 12:1247833-1247855 CTAAAAATAGAAAAGTAGCCGGG + Intronic
1092419336 12:8317052-8317074 CAAAAAATACAGAATTAGCCGGG + Intergenic
1092459707 12:8675421-8675443 CAGTAAAAAGAGAGGTGGCCGGG - Intergenic
1092649731 12:10620967-10620989 CAGAATATAGTGATGGAGCTAGG - Intronic
1093461101 12:19407596-19407618 AAGAAAAAAGAGATGGAGGCTGG - Intronic
1094576872 12:31694583-31694605 CAAAAAATAAAAAAGTAGCCAGG + Intronic
1094679860 12:32658499-32658521 TATAAAATAGAGATCTGGCCGGG + Intergenic
1095050675 12:37551534-37551556 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1095200149 12:39374759-39374781 TAGAAAACAGACATGTAGCATGG - Intronic
1095448735 12:42307431-42307453 AAGAAAATAAAGATTCAGCCTGG - Intronic
1095459002 12:42421675-42421697 AAGAAATTAGAGAAGCAGCCAGG + Intronic
1096304997 12:50466458-50466480 CAAAAAATAAAAATTTAGCCAGG + Intronic
1096336414 12:50760091-50760113 TAGAAAAGAGAGATGTGGCCAGG - Intergenic
1096547322 12:52349295-52349317 CAGAAGACAGAGATTAAGCCAGG - Intergenic
1096741764 12:53698653-53698675 CAGAAGACAGAGATGAGGCCAGG - Intergenic
1096967407 12:55639199-55639221 CTGAAAATACAGAATTAGCCGGG - Intergenic
1097197254 12:57249909-57249931 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1097877729 12:64658907-64658929 CAGAAAATAAAAAATTAGCCAGG + Intronic
1097958377 12:65509273-65509295 CAGAAGTAAGAGATTTAGCCAGG - Intergenic
1098083053 12:66810123-66810145 CAGAAAATAAAAAGGTAGACAGG + Intergenic
1098252572 12:68585445-68585467 CAAAAAATAAAAATTTAGCCAGG - Intergenic
1098737512 12:74125569-74125591 CTGAAAATACAAATCTAGCCAGG + Intergenic
1099715185 12:86283756-86283778 AGACAAATAGAGATGTAGCCAGG - Intronic
1100129618 12:91475244-91475266 AAGAAAACAGAGATGTACGCAGG - Intergenic
1101366961 12:104081742-104081764 TAAAAAATAGAGCTGTAGCCAGG + Intronic
1101670958 12:106872505-106872527 CTGAAAATACAAATTTAGCCGGG + Intronic
1101992995 12:109502652-109502674 CAGAAAATAGAGATGTAGCCAGG + Intronic
1102688563 12:114742695-114742717 CAGAAAAGAGAGATGGAGGCAGG + Intergenic
1102841184 12:116125173-116125195 CAAAAAATAATTATGTAGCCAGG + Intronic
1103319769 12:120085288-120085310 CAAAAAAAAAAGAAGTAGCCAGG + Intronic
1103628521 12:122240030-122240052 CAGAAACTAGACATGTGGCTGGG + Intronic
1104826914 12:131718050-131718072 CAAAAATCAGAGATGAAGCCGGG - Intronic
1104850447 12:131870827-131870849 CACAAAACAGAGAACTAGCCTGG - Intergenic
1105309241 13:19191566-19191588 CAGGAAATAGACCTGTGGCCAGG + Intergenic
1105528355 13:21196541-21196563 CAGAAAATAGACCTGTGGCTAGG - Intergenic
1106120755 13:26858436-26858458 CAGAAAATGGAGCTGGAGCAGGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1108842579 13:54638536-54638558 CAGAAAATAGAAATGCACTCAGG + Intergenic
1109243182 13:59917593-59917615 GAGTAAATAGAGATTTGGCCAGG + Intronic
1109578765 13:64298228-64298250 AAGAAAATAAAAATGTAGGCCGG + Intergenic
1111230175 13:85335171-85335193 GAGAAAATGGAGATTTAACCAGG - Intergenic
1111697848 13:91647774-91647796 AAGAAAATTGAGAGGGAGCCAGG - Intronic
1113494728 13:110717664-110717686 CTGAAAATACAGAATTAGCCGGG + Intronic
1114055136 14:18961815-18961837 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
1114107406 14:19439963-19439985 TAGAAAATGCAGAAGTAGCCTGG + Intergenic
1114534562 14:23414692-23414714 CAGAAAGCAAATATGTAGCCAGG - Intronic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114619923 14:24089405-24089427 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1114629373 14:24149344-24149366 CAGCAGATTCAGATGTAGCCTGG + Intronic
1115226484 14:31108249-31108271 CTGAAAATACAGAATTAGCCAGG - Intronic
1119720547 14:76887229-76887251 CAGAACACAGAAATGAAGCCAGG + Intergenic
1119917229 14:78413444-78413466 CTGAAAATAGAAAATTAGCCGGG - Intronic
1120432321 14:84434765-84434787 GAGAAAATAGAGATGCAAACTGG + Intergenic
1121652597 14:95570409-95570431 TAGAAAAAAGAAATGAAGCCTGG - Intergenic
1121686304 14:95837854-95837876 CATAAAATAGAGCTGTAGACTGG - Intergenic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1123517835 15:21046052-21046074 CTGAAAATACAGAATTAGCCGGG + Intergenic
1124866529 15:33497421-33497443 GAGAAGTTAGAGATGAAGCCTGG - Intronic
1124930335 15:34113504-34113526 CAGAAAATAAACAATTAGCCAGG - Intergenic
1125132509 15:36300228-36300250 CAGGAAATAGAGAAGCATCCAGG + Intergenic
1126585478 15:50281794-50281816 TAGAAAAAAGAGATATAGACTGG + Intronic
1127426397 15:58863210-58863232 CTGAAAATACAGAATTAGCCAGG - Intergenic
1127460464 15:59194011-59194033 CTAAAAATATAGAAGTAGCCAGG + Intronic
1128030757 15:64477923-64477945 CAGAAATAAGATATGCAGCCAGG - Intronic
1128657946 15:69476248-69476270 CAGCAACTAGAGAAGGAGCCAGG - Intergenic
1129385555 15:75194251-75194273 CAGAGCAGAGAGATGTGGCCAGG + Intergenic
1129454931 15:75671676-75671698 CTGAGAATAGAAATGTAACCAGG + Intergenic
1130742938 15:86620666-86620688 CAGAAAGTAGAAATGCAGCAGGG - Intronic
1131709649 15:95038764-95038786 CATAAAATTGAAATGCAGCCAGG + Intergenic
1131811503 15:96178541-96178563 CAAAAAGTAGAAATGTGGCCTGG - Intergenic
1131813738 15:96201264-96201286 CCGAAAATAGAGACGTAGGAAGG - Intergenic
1133115709 16:3576963-3576985 TAGAAAAAAGAGATGTGGCCAGG - Intronic
1134318526 16:13141521-13141543 CTGAAAATACAAATTTAGCCAGG + Intronic
1134869736 16:17640996-17641018 GAGAAAACAGAGATGAAGCGTGG - Intergenic
1135180508 16:20269750-20269772 CAGTAAACAGAGATGTAGGCAGG - Intergenic
1135432886 16:22401487-22401509 CACAAAATAAAAATTTAGCCAGG + Intronic
1135435996 16:22427139-22427161 CAAAAAATACAAAAGTAGCCAGG - Intronic
1135600793 16:23781851-23781873 CAGAAAACAGAGTTGGGGCCAGG - Intergenic
1136901797 16:34048104-34048126 GAAAAAATAGAGATGTAGATGGG - Intergenic
1137519426 16:49179545-49179567 GAGAAAACAGAGATTTGGCCAGG + Intergenic
1137833469 16:51567535-51567557 CAGAAAAAAAAAAAGTAGCCAGG - Intergenic
1139267064 16:65649812-65649834 AAGTAAAGAGAGATGCAGCCTGG - Intergenic
1140587866 16:76315538-76315560 CAGCAAAAAGAGATGTAAACTGG - Intronic
1140710257 16:77670939-77670961 CAGAAAACAGACCTGCAGCCAGG + Intergenic
1140761568 16:78113562-78113584 CAGAAAAGTGAGAACTAGCCAGG - Intronic
1140854950 16:78969811-78969833 CAGAAAGTAGAGTGGTTGCCAGG + Intronic
1141093233 16:81144802-81144824 TAGAAAATAGAGGTGTTGGCTGG - Intergenic
1142045203 16:87920952-87920974 CAAAAAATACAAAAGTAGCCAGG - Intronic
1142317724 16:89358984-89359006 CAAAAAATAGAAAATTAGCCAGG - Intronic
1142463035 17:108752-108774 CTGAAAATACAGAATTAGCCAGG - Intergenic
1142982057 17:3678071-3678093 CAGACAGTGGAGATGTAGCCAGG - Intronic
1144567172 17:16369194-16369216 TAAAAAAGAAAGATGTAGCCTGG - Intergenic
1144870719 17:18368924-18368946 CAGAAAATAAAAAATTAGCCAGG - Intergenic
1145279042 17:21455185-21455207 CAAAAAATAAAAATGTAGCCGGG - Intergenic
1145692642 17:26759240-26759262 CAGAAAAATGACATGAAGCCGGG + Intergenic
1145894378 17:28445128-28445150 CAAAAAATAAAGAACTAGCCGGG + Intergenic
1146358559 17:32155701-32155723 CAGAAAATAAAAAATTAGCCAGG - Intronic
1147398147 17:40161383-40161405 TAGAAAATTGAAATGCAGCCAGG + Intronic
1148322068 17:46763206-46763228 CAGAAAGAAGAGATGCAGCAGGG - Exonic
1150340259 17:64360981-64361003 CAAAAAATAAAGAATTAGCCAGG - Intronic
1150735355 17:67732322-67732344 AAGAAAATACAGAATTAGCCGGG + Intronic
1150758009 17:67933406-67933428 CAAAAAATAAAAATTTAGCCAGG + Intronic
1151848984 17:76678550-76678572 CAGAAGAGTGAGATGCAGCCAGG - Intronic
1152043495 17:77920418-77920440 CTAAAAATACAGATGTGGCCAGG + Intergenic
1153882319 18:9432273-9432295 AAGAAAATTGAGAATTAGCCAGG - Intergenic
1155044305 18:22090130-22090152 CAGCAAATTGAGAGGGAGCCAGG + Intronic
1155174877 18:23293081-23293103 AAGAAAATACAAAAGTAGCCAGG + Intronic
1155185189 18:23381499-23381521 TAGAAAATACAGATGGAGGCCGG - Intronic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1155606186 18:27608662-27608684 CTGAAAATACAGAATTAGCCCGG + Intergenic
1155961350 18:31998003-31998025 CTGAAAATACAGAATTAGCCAGG - Intergenic
1157063256 18:44318493-44318515 CAAAAAAAAAAAATGTAGCCAGG - Intergenic
1157243593 18:46034114-46034136 CCGGAAACAGAGCTGTAGCCAGG + Intronic
1158429054 18:57367279-57367301 AAGAAAATAGAGGTATAACCTGG - Exonic
1159087278 18:63808057-63808079 CTGACAATTGAGATGAAGCCTGG - Intergenic
1159153857 18:64556520-64556542 CAGAAAAGAGACATGTGGGCTGG - Intergenic
1160961564 19:1724098-1724120 CAAAAAATACAAAAGTAGCCAGG + Intergenic
1161215262 19:3091896-3091918 CTGAAAATACAGAATTAGCCAGG - Intergenic
1161913970 19:7215114-7215136 CAAAAAATAAAAATTTAGCCAGG - Intronic
1163471226 19:17498206-17498228 CAGAAAATAAAAAATTAGCCAGG + Intronic
1165229035 19:34374887-34374909 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166097547 19:40550449-40550471 CAGCAGATACAGATGTATCCAGG + Intronic
1166278808 19:41775885-41775907 CAAAAAAAAAAAATGTAGCCAGG - Intergenic
1166586536 19:43953919-43953941 CAAAAAATAGAAAATTAGCCAGG + Intronic
1167047913 19:47061973-47061995 CAGAAAAAACAAATTTAGCCAGG - Intergenic
1167142236 19:47659958-47659980 TAGAAGATATATATGTAGCCTGG - Intronic
1167162121 19:47774909-47774931 AAAAAAATAGAGATGGAGCCAGG - Intergenic
1167790766 19:51678188-51678210 GACTAAATAGAGATGTAGGCAGG - Intergenic
1168050420 19:53825604-53825626 CAAAAAAAAGAGAATTAGCCAGG - Intergenic
1168112571 19:54201877-54201899 CAGAATATAAAGATATAGACGGG - Intronic
1168283469 19:55318966-55318988 CAAAAAATAAAGAATTAGCCAGG - Intronic
925342807 2:3148615-3148637 CAGTAAATACAGAGGTTGCCTGG - Intergenic
925980778 2:9175455-9175477 CAGAAAATGGATATGAAGGCAGG - Intergenic
926117983 2:10225314-10225336 CAAACAACAGAGATGTGGCCGGG - Intergenic
930129408 2:47833961-47833983 TTGAAAATAAAGATGCAGCCAGG - Intronic
930899374 2:56484947-56484969 CAGAATATAGAGTTGTAGAGAGG - Intergenic
931689274 2:64821575-64821597 CTGAAAATACAAAAGTAGCCGGG - Intergenic
932388828 2:71366053-71366075 CAGAAAACAAAGTTGTTGCCAGG + Intronic
933321088 2:80776695-80776717 AAGAAAATAGAAAGGCAGCCAGG + Intergenic
933700871 2:85254656-85254678 CAGAAACCAGAGTTCTAGCCTGG - Intronic
934712556 2:96525547-96525569 CTTAAAATGGAGATGTAGCCTGG + Intergenic
935017286 2:99195919-99195941 CTGAAAATACAGAATTAGCCAGG + Exonic
935634524 2:105239840-105239862 CAGAAAATTGAGATGAAGAAGGG + Intergenic
936841576 2:116776036-116776058 CTCAAATTAGAGATGTAGGCCGG + Intergenic
937155160 2:119713910-119713932 TAGAAAATGGAGATGGAGCCTGG - Intergenic
938473146 2:131584604-131584626 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
939129284 2:138214742-138214764 CAGAAAATCAGGAAGTAGCCAGG - Intergenic
939567918 2:143806655-143806677 CATAAAAGAGAGATGTTGACAGG + Intergenic
939677707 2:145093226-145093248 CACAAAAGAAAGATGTAGGCTGG + Intergenic
940505537 2:154548004-154548026 AAGAAAAAAGAGGTTTAGCCAGG - Intergenic
941893553 2:170606857-170606879 CAGAAAATACAAAATTAGCCAGG + Intronic
941917683 2:170823109-170823131 CAGAAAATACGGATGTCCCCGGG + Intronic
941982120 2:171470182-171470204 CAAAAAATAAAAAAGTAGCCAGG - Intronic
942589828 2:177530759-177530781 CAGAGAAAACAGATGTAGTCTGG + Intronic
944455132 2:199885370-199885392 CAAAAAATACAAAAGTAGCCAGG + Intergenic
944656467 2:201880962-201880984 CAGAAGAGAGAGAAGCAGCCAGG + Intronic
944810076 2:203319142-203319164 CATAAAATAGAAAATTAGCCAGG - Intergenic
944951543 2:204755986-204756008 CAGAAGATAGACAAGTATCCAGG - Intronic
945006938 2:205418531-205418553 GAGAAAATAGTGTTGTAGCTGGG + Intronic
945264218 2:207874411-207874433 CTGAAAATACAAAAGTAGCCAGG + Intronic
945272860 2:207959329-207959351 CATAAAAGAGAGATGTAACTGGG - Intronic
945991144 2:216396318-216396340 AAAAAAATAAAGATGTAGCTGGG + Intergenic
946838920 2:223800369-223800391 CAGAAAATAAATAAATAGCCAGG + Intronic
948401089 2:237685996-237686018 CAGAAAATAGAGACATCTCCTGG - Intronic
1169156013 20:3330401-3330423 CAGAAAATAAAAAATTAGCCAGG - Intronic
1169160018 20:3369535-3369557 CTAAAAATAGAAAAGTAGCCGGG - Intronic
1170427893 20:16253626-16253648 CAGAAAATACAGATTCATCCAGG + Intergenic
1171545185 20:25995002-25995024 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1172129117 20:32644150-32644172 TAGAAAAAGGAGTTGTAGCCAGG + Intergenic
1172705583 20:36879892-36879914 AAAAAAATAGAGATGTACACTGG + Intronic
1172726776 20:37049899-37049921 CAAAAAATACAAAAGTAGCCAGG + Intronic
1172754287 20:37272547-37272569 CAAAAAATACAAAAGTAGCCTGG - Intergenic
1172938149 20:38635500-38635522 CAAAAAATAAAAAAGTAGCCAGG + Intronic
1174015104 20:47481468-47481490 CAAAAAATACAAAAGTAGCCAGG + Intergenic
1174717719 20:52777685-52777707 TAGAAAATGGAGATAGAGCCAGG - Intergenic
1175660092 20:60804851-60804873 CAGAAAGAAGAGGTGCAGCCTGG - Intergenic
1175783475 20:61697956-61697978 CAGAAGTCAGAGATGGAGCCAGG + Intronic
1176725187 21:10425961-10425983 CAGAAAATAGAGAAATATCAGGG - Intergenic
1177259301 21:18708361-18708383 CAGAAATTAGAGATTCAGCAGGG + Intergenic
1177395220 21:20525818-20525840 CAGAAAATATAGATATATTCAGG + Intergenic
1177508047 21:22043024-22043046 CAGATAATAGATATGCAGCAGGG + Intergenic
1177849585 21:26330620-26330642 CTGAAAATAAAAATTTAGCCAGG - Intergenic
1178037797 21:28604069-28604091 CAGAAAGTAGAGATTGAACCAGG - Intergenic
1178057906 21:28819841-28819863 TAGAAAATAAAGGTGGAGCCAGG - Intergenic
1178116125 21:29418585-29418607 GAGAGAATAGATAGGTAGCCAGG + Intronic
1178416412 21:32408733-32408755 AGGAAAATAGAGATGTAACATGG + Intergenic
1180473618 22:15684365-15684387 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
1180685239 22:17661071-17661093 AAGAAAAAAGAAATGGAGCCAGG - Intronic
1180792432 22:18583226-18583248 CAGAAAATAAAAAATTAGCCGGG - Intergenic
1181229305 22:21412092-21412114 CAGAAAATAAAAAATTAGCCGGG + Intergenic
1181249345 22:21522772-21522794 CAGAAAATAAAAAATTAGCCGGG - Intergenic
1182625541 22:31643117-31643139 AAGAAAATAGAGATAAAGACAGG + Intronic
1182662487 22:31934809-31934831 CAAAAAATAGAAAATTAGCCAGG + Intronic
1182856267 22:33520233-33520255 CAGAAAATAAAAAATTAGCCAGG - Intronic
949435957 3:4029451-4029473 CAGAAGACAGAGCTTTAGCCAGG - Intronic
949764238 3:7508275-7508297 TAGAAAATAAAGATTAAGCCAGG + Intronic
949942285 3:9164156-9164178 CTGAAAATACAGAATTAGCCAGG - Intronic
951532889 3:23714237-23714259 CAGAAAATAGGGCTGTAGTGAGG + Intergenic
952332268 3:32375020-32375042 CAGAAAATACAAAATTAGCCAGG - Intergenic
953035496 3:39207038-39207060 AAGAAAAGAGGGATGAAGCCAGG + Intergenic
954198458 3:49010015-49010037 AAAAAAATAGAGATGGGGCCTGG - Intronic
954255597 3:49403564-49403586 TACAAAATAAAAATGTAGCCAGG + Intronic
956422928 3:69103477-69103499 CACAAAATAAAGATGTGGCTGGG - Intronic
960084818 3:113579122-113579144 CAGAAACTGGGGAGGTAGCCAGG + Intronic
960585510 3:119317470-119317492 CTGAAAATAGAAATGTGGCCAGG - Intronic
961172244 3:124805610-124805632 CAGAAAATAAAAAATTAGCCGGG - Intronic
961917598 3:130393294-130393316 CAGAAAAGTGAGACGTAGGCAGG - Intronic
962872587 3:139510790-139510812 CATAAAATAGAGAGGCAACCAGG - Intergenic
962884798 3:139614324-139614346 CAGAAAGTAGGGAAGTAGTCAGG - Intronic
964724803 3:159803745-159803767 AAGAAAACAGAGAAGTAGCCAGG - Intronic
965762343 3:172092977-172092999 CAAAAAATAAAAAAGTAGCCAGG - Intronic
966906230 3:184527803-184527825 TAGAAACCAGAGATGTGGCCGGG - Intronic
967345961 3:188456051-188456073 CAAAAAATAGAAAATTAGCCAGG - Intronic
967575324 3:191083111-191083133 TAGAAAATAGAGAAATAGGCTGG + Intergenic
968089439 3:195891243-195891265 CTGAAAATAGAAAATTAGCCGGG + Intronic
968279886 3:197468439-197468461 AAGAAAATAAAGATGCAGCTGGG + Intergenic
968763686 4:2457111-2457133 CAGAAAATACAAAACTAGCCAGG - Intronic
969727362 4:8928735-8928757 CAAAAAATAGAAAATTAGCCAGG - Intergenic
970330263 4:14975259-14975281 CAGAAAAAAAAAATGTGGCCTGG - Intergenic
970393310 4:15639001-15639023 CTAAAAATACAGAAGTAGCCGGG + Intronic
970548558 4:17155527-17155549 GAGAAAATGGAGATGTGGCAGGG - Intergenic
970910072 4:21264733-21264755 CAGAAAAGAGAAACTTAGCCTGG + Intronic
971718193 4:30208929-30208951 CAAAAAATAAATATGTGGCCGGG + Intergenic
972095808 4:35345385-35345407 CATGAAAGAAAGATGTAGCCTGG - Intergenic
972282510 4:37616464-37616486 CAGAAACTAGAAATGCTGCCAGG + Intronic
972766482 4:42156256-42156278 CAGAAAATAAAAAATTAGCCAGG + Intergenic
974354626 4:60796457-60796479 CCTAGAATAGAGATGTAGCAAGG - Intergenic
975694698 4:77000405-77000427 CAGAAAATAAAGGTGAAGCCAGG + Intronic
975867523 4:78739298-78739320 CAGAAAATACAAAATTAGCCAGG - Intergenic
976228400 4:82815198-82815220 CAGAAAATTGTCATGTATCCTGG - Intergenic
976253630 4:83078420-83078442 CAAAAAATATAAAAGTAGCCAGG + Intergenic
977531695 4:98207941-98207963 CAGAAAATAAAAAATTAGCCAGG - Intergenic
977932527 4:102764236-102764258 CCAAAATTAGAGATGTAGACAGG + Intergenic
978237445 4:106476120-106476142 CAGAAAATAGAAATAAAGACAGG + Intergenic
978326062 4:107557530-107557552 CAGAAAACAGAGAAATAGCAGGG - Intergenic
978648389 4:110970327-110970349 AAGAAAAGAGAAATGTGGCCTGG + Intergenic
978962636 4:114702234-114702256 AAGAAAATAGAGATGTGTCCTGG + Intergenic
979032267 4:115665231-115665253 CAGGAAAGTGACATGTAGCCTGG - Intergenic
981808825 4:148750110-148750132 AAGAAAATAGAAATATAGGCTGG + Intergenic
982869344 4:160556897-160556919 GAGAAAATAGAGCTATGGCCAGG - Intergenic
983183371 4:164674703-164674725 CAATAAATAGAGATGAATCCTGG - Intergenic
983289641 4:165785695-165785717 CAGAAAGTAGAGATGTTGAAGGG + Intergenic
983538753 4:168886478-168886500 CAAAAAATGGAAATTTAGCCAGG + Intronic
983555308 4:169054269-169054291 AAAAATATGGAGATGTAGCCGGG - Intergenic
983906800 4:173191605-173191627 CAGAAATTAGAGATGGATCTGGG + Intronic
984083941 4:175284977-175284999 AAGAAAATATGGATGTAGGCGGG - Intergenic
984679651 4:182592835-182592857 GAGAAAGTAAAGATATAGCCAGG + Intronic
986380715 5:7182831-7182853 CACAAAACAGAGAGGTAGCAGGG - Intergenic
986672231 5:10152502-10152524 AAGAAAACAGAGATCTAGTCAGG - Intergenic
987127730 5:14830678-14830700 TACAAAATAGAGCTGCAGCCTGG - Intronic
987229489 5:15878720-15878742 GAGAAAATGGAGACGCAGCCAGG + Intronic
987768477 5:22267845-22267867 CAGAAAATAGAGCTGAAGCCTGG + Intronic
987783828 5:22472657-22472679 AATAAAATAGAGATGTATCTAGG - Intronic
988801822 5:34702865-34702887 CTGAAAATATAGAATTAGCCAGG - Intronic
991156229 5:63439667-63439689 GAGAGAATAAAGATCTAGCCGGG + Intergenic
991662283 5:68962399-68962421 CAGAAAATACAAAAATAGCCAGG + Intergenic
992719241 5:79543531-79543553 CAGAAAATACAAAATTAGCCGGG - Intergenic
993739288 5:91517971-91517993 AAGAGACTAGAAATGTAGCCAGG + Intergenic
994281838 5:97913924-97913946 TAGAAAATAGAAATTAAGCCTGG + Intergenic
994413717 5:99441643-99441665 CAGACAACAAAGATGTAGCCAGG - Intergenic
994715398 5:103315549-103315571 CAGAAAGTAGAGAAGTAGTAAGG + Intergenic
994752415 5:103754726-103754748 CAATAAATATAAATGTAGCCAGG + Intergenic
995201049 5:109425543-109425565 CAGAAAATAGAAAAGAACCCTGG - Intergenic
995311846 5:110722083-110722105 CAGAAGATAGAGATGTGGTAGGG + Intronic
995982050 5:118116171-118116193 AAGAAAAGAGAGATGGAGCGTGG + Intergenic
999151210 5:149427401-149427423 CAGGAAGTGGAGATCTAGCCAGG + Intergenic
999955863 5:156700780-156700802 CAAAAAATAGAAAATTAGCCAGG + Intronic
999983131 5:156976896-156976918 TAGAAAATAGATATGAAGGCTGG - Intergenic
1000231139 5:159316409-159316431 AAGAAAAGAGAGAGGTAGCCAGG - Intronic
1000457500 5:161469883-161469905 GAGAAAATAGAGATGAAGAAAGG - Intronic
1001462156 5:171925385-171925407 CAGAAAATTGAACAGTAGCCTGG - Intronic
1001609536 5:172989123-172989145 CAGAAAATAGAGACCAAGCCTGG + Intronic
1001711947 5:173786176-173786198 CAGAAAGGAGAGACGTAGGCCGG + Intergenic
1002127093 5:177054230-177054252 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1002135182 5:177103203-177103225 CAAAAAATAAAAAAGTAGCCGGG + Intergenic
1002301207 5:178258085-178258107 CAGAAAATAAAAAATTAGCCGGG + Intronic
1002401384 5:178993335-178993357 CAGAAACTAGAGCTCTAGGCAGG + Intronic
1002873989 6:1194431-1194453 CAGAAAAAATAGAGGTATCCTGG + Intergenic
1003103711 6:3197318-3197340 TAGAAAATAGAAATGTGGGCTGG + Intergenic
1003273617 6:4629036-4629058 AAGAAAATGAAGATGTAGGCTGG - Intergenic
1003883545 6:10500095-10500117 TAGAAAATAGAGACGGGGCCAGG + Intronic
1004654631 6:17646898-17646920 AAGAAAATACAGAATTAGCCAGG - Intronic
1004925706 6:20413262-20413284 CAGAGGATAGGGATGGAGCCTGG - Intronic
1005597548 6:27393936-27393958 CAGCAAAGGAAGATGTAGCCTGG + Intronic
1005673552 6:28131309-28131331 CTCAAATTAGAGATGTGGCCAGG - Intergenic
1005685511 6:28249998-28250020 CTGAAAACGGAGATGTGGCCCGG + Intronic
1006261892 6:32881330-32881352 CTGAAAATACAAAAGTAGCCAGG + Intergenic
1006544622 6:34769487-34769509 AAGAAAATAGTGAGGTAGGCTGG - Intronic
1007210956 6:40193068-40193090 CAGGAATTACAGATGTACCCTGG - Intergenic
1008015260 6:46511436-46511458 CAGACCATTGGGATGTAGCCAGG + Intergenic
1009464767 6:63955214-63955236 CAGAAGATAGGGATGAAGGCTGG - Intronic
1010200890 6:73281176-73281198 CTAAAAATAGAAATTTAGCCAGG + Intronic
1010272112 6:73926425-73926447 AGGAAAAAAGAGATGTGGCCGGG - Intergenic
1010725671 6:79329459-79329481 CTCAAAATAGACATGTATCCTGG + Intergenic
1013184503 6:107746171-107746193 AAGAAATTAAAGAGGTAGCCAGG + Intronic
1013817592 6:114117317-114117339 TAGAAAACACAGAGGTAGCCTGG + Intronic
1014011618 6:116482552-116482574 GAGAAAACAGAGATTTAGCAGGG + Intergenic
1015859265 6:137658464-137658486 CAGTGAATAGAGATTTAGCATGG + Intergenic
1015882559 6:137883640-137883662 CAGGAAAGAGAGAAGTAGGCAGG + Intergenic
1017061287 6:150487551-150487573 CAAAAAATAAAGAATTAGCCGGG - Intergenic
1018648204 6:165967653-165967675 CAGAAAATAGAGAAGTGTCTTGG + Intronic
1019405204 7:879639-879661 CAGTAAAATGCGATGTAGCCTGG - Intronic
1019696521 7:2449381-2449403 CACAAAATATAAATTTAGCCAGG - Intergenic
1020046948 7:5047236-5047258 CAAAAAATACAAAAGTAGCCAGG + Intronic
1020087108 7:5316438-5316460 CTGAAAATACAGAATTAGCCAGG - Intronic
1020292305 7:6731115-6731137 CAAAAAATACAAAAGTAGCCAGG + Intergenic
1020434832 7:8151426-8151448 CAGAAAATTGGGATGCATCCAGG - Intronic
1020913636 7:14165043-14165065 CAGAAAATAGAAATGAGGGCTGG - Intronic
1021568185 7:22035326-22035348 CAGAAAAGACAGATGAGGCCAGG - Intergenic
1022191524 7:28020913-28020935 CAGGAAATAGAAAAGTAACCTGG + Intronic
1022686896 7:32605567-32605589 CAGAAAATAAAAAATTAGCCAGG + Intergenic
1022835697 7:34111872-34111894 CTAAAAATACAGAAGTAGCCAGG - Intronic
1023030063 7:36083504-36083526 CAAAAAATAAAGAAATAGCCAGG - Intronic
1023853869 7:44168604-44168626 CTGAAAATACAGAATTAGCCAGG - Intronic
1025296597 7:57780074-57780096 CTAAAAATACAGAAGTAGCCAGG + Intergenic
1026054674 7:66973993-66974015 CTGAAAATAGAAAATTAGCCAGG + Intergenic
1026603911 7:71799769-71799791 CAGAAAATAGAGACCCAGCTGGG - Intronic
1026644049 7:72152616-72152638 CAGAAACTTGAGATGTTTCCCGG + Intronic
1026664023 7:72326369-72326391 GAAGAAACAGAGATGTAGCCAGG - Intronic
1026683350 7:72487388-72487410 GAGAAAATAGAGAGGTGGCCAGG + Intergenic
1027252012 7:76404720-76404742 CAGGAGATCGAGATATAGCCTGG + Intronic
1028068408 7:86417583-86417605 AAAAAAATAGAGAAGTGGCCAGG - Intergenic
1028893823 7:96018524-96018546 AAGTAAATAGCCATGTAGCCGGG + Intronic
1029695389 7:102209739-102209761 CAGAAATGAGGGATGAAGCCTGG - Intronic
1029793658 7:102871544-102871566 CAGAAAAAAAAAATTTAGCCAGG - Intronic
1030289079 7:107854600-107854622 GTGAAAATATAGATGTAGCTGGG + Intergenic
1030362544 7:108610246-108610268 CAAAAAATAAAAAAGTAGCCAGG - Intergenic
1030573612 7:111258665-111258687 CTAAAAATACAAATGTAGCCAGG - Intronic
1030851775 7:114495800-114495822 TAGAAAATAAAAATGTGGCCGGG - Intronic
1032131166 7:129229226-129229248 CTGAAAATAGAAAATTAGCCGGG - Intronic
1032183509 7:129702702-129702724 CAGAAAACAGGAATGTAGCAGGG - Intronic
1032681996 7:134194578-134194600 CAAAAAATAAAGAATTAGCCTGG + Intronic
1033929489 7:146505520-146505542 CAGGAAATACAGATGTTCCCTGG + Intronic
1034085327 7:148317192-148317214 CAAAAAATACAGAATTAGCCAGG + Intronic
1034748013 7:153541233-153541255 CTAAAAATAGAAAAGTAGCCAGG - Intergenic
1035585744 8:772060-772082 CAAAAAATAGAAAATTAGCCAGG - Intergenic
1036009549 8:4706710-4706732 CAAAAGACAGAGATGTGGCCGGG + Intronic
1036555876 8:9860039-9860061 AAGAAAATAGAAAAGAAGCCGGG - Intergenic
1037512777 8:19600374-19600396 TACAAAATAGAGAAGTAGGCTGG - Intronic
1038374611 8:27026379-27026401 TAAAAAATTGAGATGTGGCCAGG - Intergenic
1038513315 8:28161276-28161298 TAGAAAGTAGAGAGGTGGCCGGG + Intronic
1038761994 8:30392801-30392823 TAGAAAATAGAGATGTGGAAAGG + Intronic
1038773902 8:30510738-30510760 CAAAAAATAAAGATTTAGCTGGG - Intronic
1039591625 8:38754865-38754887 CATAAAAGAGAGATCTGGCCGGG + Intronic
1039812229 8:41059343-41059365 CTGAAAATACAGAATTAGCCAGG + Intergenic
1041297128 8:56368913-56368935 CGGAAAATACAAAAGTAGCCAGG + Intergenic
1041583143 8:59485703-59485725 TAAAAAATAGAGATTTAGGCTGG - Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1042247053 8:66718319-66718341 TAGAAAATAGGGAGGTAGGCTGG - Intronic
1042351430 8:67781388-67781410 CAAAAATTAAAAATGTAGCCAGG - Intergenic
1042670387 8:71256510-71256532 CAGAAAGAATAGATGTTGCCAGG + Intronic
1044591752 8:93919364-93919386 CTGAAAATACAGAATTAGCCGGG + Intronic
1044799141 8:95935335-95935357 TAGAAAAAAAAGTTGTAGCCAGG - Intergenic
1046059559 8:109120921-109120943 CATAAAATAGGGATATAGGCTGG - Intergenic
1046179541 8:110626019-110626041 CAAAAAATACAAAAGTAGCCGGG - Intergenic
1046745178 8:117868609-117868631 CAAAAAATAAAAAAGTAGCCAGG - Intronic
1046792704 8:118339166-118339188 CAGAAAATAAAAAATTAGCCAGG + Intronic
1048013526 8:130477734-130477756 AAGAAAAAAGAAATGTGGCCGGG - Intergenic
1049539398 8:143200864-143200886 CAGAAAATACAAAATTAGCCAGG + Intergenic
1049855050 8:144856473-144856495 TAGAAAATAGTGAGGTAACCAGG - Intergenic
1050052128 9:1613639-1613661 CAGAATAAAGAGAGATAGCCTGG + Intergenic
1050111773 9:2224410-2224432 CAGAAAATAAAAAATTAGCCGGG - Intergenic
1050353835 9:4764550-4764572 TAAAAAATAGAGATGGAGTCAGG + Intergenic
1050470608 9:5985622-5985644 CTGAAAATACAGAATTAGCCGGG + Intronic
1050519616 9:6483982-6484004 CAGAAAATGATGATGAAGCCGGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050736851 9:8773839-8773861 CAGAAAAGAGAGTTCTAGACAGG - Intronic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051206896 9:14697500-14697522 AGGAAAAGAGAGATTTAGCCAGG - Intergenic
1051465946 9:17378070-17378092 AAGAAAATAGATATGAAGGCCGG - Intronic
1051509458 9:17861306-17861328 CAGAAAAGAGAGATCTGGGCAGG + Intergenic
1051885700 9:21890342-21890364 CAGCAAGGAGACATGTAGCCTGG - Intronic
1052927713 9:34031330-34031352 CTGAAAATACAAATTTAGCCAGG + Intronic
1053252268 9:36584626-36584648 AAGAAAATAAAGATGGGGCCGGG - Intronic
1053461908 9:38277946-38277968 CAGCAAGTTGAGATGGAGCCCGG - Intergenic
1055645649 9:78359008-78359030 CAAAAAATACAGAAATAGCCAGG + Intergenic
1056531279 9:87489949-87489971 CAGAAAATAAAAAATTAGCCAGG + Intergenic
1056637393 9:88342600-88342622 AAGGAAATAGAGAAGTAGCCTGG - Intergenic
1056672834 9:88646114-88646136 CAAAAAAGAGACATGTGGCCGGG + Intergenic
1057577839 9:96257823-96257845 CAAAAAATAAAGAATTAGCCGGG - Intronic
1057826231 9:98374219-98374241 CACAAAATAGACAAGTGGCCTGG - Intronic
1058239114 9:102534134-102534156 CAGAAAACAGAAACGTAGCGGGG - Intergenic
1058700951 9:107599751-107599773 GAGAAAGCAGAGATGTAGCGAGG + Intergenic
1059667473 9:116462414-116462436 CAAAGAATTGAGATGTAGCATGG - Intronic
1060672438 9:125481581-125481603 CAGAAAATACAAAAATAGCCAGG - Intronic
1061317445 9:129805149-129805171 AAAAAAAGAGAGATGTAGTCAGG + Intronic
1185594817 X:1299620-1299642 CAGAAAATAAAATTTTAGCCAGG + Intronic
1185784604 X:2879558-2879580 TAGAAAATAGATAGATAGCCGGG - Intronic
1185819604 X:3189378-3189400 CAAAAAATAAAAATTTAGCCAGG - Intergenic
1185827253 X:3263983-3264005 CAGCATATAGAGATGGGGCCAGG - Intergenic
1188944980 X:36289512-36289534 CAAAAAATGAAGATGTAGCTAGG + Intronic
1189757822 X:44289653-44289675 AAGAAAAGAAAGATGTAGACCGG - Intronic
1189859240 X:45255341-45255363 CAGAAATAAGAGCTATAGCCAGG - Intergenic
1190074979 X:47310305-47310327 CAAAAAATAAAAATTTAGCCAGG - Intergenic
1190736621 X:53259637-53259659 CAGAAAATAAAAAATTAGCCAGG + Intronic
1190739927 X:53281851-53281873 CAGAAAATTGAGATGGAGAGAGG + Intronic
1191135429 X:57058899-57058921 CTGAAAAGAGAGCTGAAGCCAGG - Intergenic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1191757789 X:64613043-64613065 GAGAAAATTGAGATGAAGCTAGG - Intergenic
1191786491 X:64922031-64922053 GAGAAAATAGAAATGGAGCCAGG + Intronic
1195205595 X:102597087-102597109 CAAAAAAGAGAAATGAAGCCTGG + Intergenic
1195643511 X:107203539-107203561 TTGAAAAGGGAGATGTAGCCAGG - Intronic
1196500671 X:116377692-116377714 TAAAAACCAGAGATGTAGCCAGG + Intergenic
1196873319 X:120133693-120133715 CAGAAAATAAAAAATTAGCCGGG - Intergenic
1197464090 X:126782654-126782676 CAGAAAGTAGAAGTGTGGCCTGG - Intergenic
1197667401 X:129238604-129238626 AGGAAACTATAGATGTAGCCAGG - Intergenic
1198508797 X:137328252-137328274 CTGGAACTAGAGAAGTAGCCAGG + Intergenic
1199415076 X:147573136-147573158 CAGAAAATAGAGAGGAAGGGCGG + Intergenic
1199973981 X:152881171-152881193 TAGAAAATAAAAAAGTAGCCAGG - Intergenic
1200180614 X:154148235-154148257 CACCAAATAGAGATAGAGCCTGG - Intronic
1201331556 Y:12827798-12827820 CAAAAAATAGAAAACTAGCCAGG + Intronic
1201594338 Y:15651049-15651071 CAGAGAGTTGAGATGTAGGCAGG - Intergenic