ID: 1101994670

View in Genome Browser
Species Human (GRCh38)
Location 12:109516475-109516497
Sequence CCTTGAGGAGGATTTTCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101994662_1101994670 -10 Left 1101994662 12:109516462-109516484 CCCCCACGCCCAGCCTTGAGGAG 0: 1
1: 5
2: 62
3: 472
4: 2556
Right 1101994670 12:109516475-109516497 CCTTGAGGAGGATTTTCTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 150
1101994655_1101994670 27 Left 1101994655 12:109516425-109516447 CCTGGGCCTCCCAGAGTGCTGGG 0: 128
1: 8874
2: 210483
3: 262279
4: 176647
Right 1101994670 12:109516475-109516497 CCTTGAGGAGGATTTTCTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 150
1101994657_1101994670 21 Left 1101994657 12:109516431-109516453 CCTCCCAGAGTGCTGGGATTACA 0: 7837
1: 299856
2: 263617
3: 151465
4: 134888
Right 1101994670 12:109516475-109516497 CCTTGAGGAGGATTTTCTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 150
1101994659_1101994670 18 Left 1101994659 12:109516434-109516456 CCCAGAGTGCTGGGATTACAGGC 0: 5645
1: 226181
2: 272263
3: 183265
4: 143363
Right 1101994670 12:109516475-109516497 CCTTGAGGAGGATTTTCTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 150
1101994660_1101994670 17 Left 1101994660 12:109516435-109516457 CCAGAGTGCTGGGATTACAGGCG 0: 3126
1: 130507
2: 274724
3: 221599
4: 153552
Right 1101994670 12:109516475-109516497 CCTTGAGGAGGATTTTCTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 150
1101994653_1101994670 30 Left 1101994653 12:109516422-109516444 CCACCTGGGCCTCCCAGAGTGCT 0: 87
1: 6392
2: 155071
3: 180009
4: 110973
Right 1101994670 12:109516475-109516497 CCTTGAGGAGGATTTTCTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101994670 Original CRISPR CCTTGAGGAGGATTTTCTCG TGG Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
905207133 1:36349365-36349387 CAATGAGGGGGATTTTCTCACGG + Intronic
909222662 1:72983301-72983323 CCTGGAGGAGGAGGTTCTGGAGG + Intergenic
909776693 1:79492031-79492053 CCTGGGGGAGGATGTTCTGGAGG + Intergenic
910144132 1:84058691-84058713 CCTGGGGGAGGAGTTTCTGGAGG + Intergenic
912893357 1:113558730-113558752 TCTTGGGGATGATTTTCTCATGG - Intronic
917773663 1:178309460-178309482 CCTTGAGGAAGATTTTTCCAGGG - Intronic
921509257 1:216010248-216010270 CCTGGAGGAGGAGGTTCTGGAGG - Intronic
922253253 1:223869634-223869656 CCTTGGGGTTGATCTTCTCGAGG + Intergenic
922384799 1:225072019-225072041 TCTTGGGGATGATCTTCTCGTGG + Intronic
924411942 1:243815427-243815449 CTTTGAGAAGGCTTTGCTCGAGG - Intronic
924668699 1:246100856-246100878 CCATGAGGAGGATATTATCATGG + Intronic
1067833107 10:49621588-49621610 CCTTGTGGAAAATTTTCTCCTGG - Intronic
1070329225 10:75405890-75405912 CCTGGAGTAGGATGTTCTCAGGG + Intergenic
1075279267 10:121125756-121125778 CCTTGAGGAGGATTTTTAAACGG - Intergenic
1080513606 11:32999930-32999952 TCTTGAGGATGATCTTCTTGTGG + Intergenic
1082066808 11:47907638-47907660 CATTGAGGGGGATTTTCCCTTGG + Intergenic
1082236172 11:49821918-49821940 CCTTGGGGAGAATTTTTTAGGGG + Intergenic
1082815075 11:57502432-57502454 CCTTCAGGAGCACTTTCTCTGGG - Intronic
1083889657 11:65589558-65589580 GCTTGAGGAGGCATTTCTCTTGG + Intronic
1085657167 11:78326878-78326900 CCTTGTTGAGGATTTACTGGAGG + Intronic
1091043940 11:132309085-132309107 CCCTGAAGAGAATTTTCTCTAGG - Intronic
1091079597 11:132654391-132654413 TCTTGGGGAGGATCTTCTCTTGG - Intronic
1091079640 11:132654578-132654600 TCTTGAGGAGGAGCTTCTCTTGG - Intronic
1093131957 12:15402408-15402430 CCTTGAGGAGGAATTCCTATTGG - Intronic
1094036141 12:26074342-26074364 CCTTCAGGAGGTTTTTTTTGAGG + Intronic
1094196340 12:27753561-27753583 CTTTGAAGGGGATTTTCTAGAGG + Intronic
1097583109 12:61482401-61482423 CCTTGGGGATGATCTTCTCATGG - Intergenic
1101994670 12:109516475-109516497 CCTTGAGGAGGATTTTCTCGTGG + Intronic
1104565945 12:129883453-129883475 CATTGAGGTGGATTTTCTGCAGG + Intronic
1104702575 12:130918282-130918304 CCTTGAGAAAGATTTCGTCGTGG + Intergenic
1105521903 13:21138821-21138843 ACTTGAGCAAGATTTTCTCTAGG + Intergenic
1105668303 13:22585342-22585364 TCTTGAGGTTGATCTTCTCGTGG + Intergenic
1108712236 13:53044886-53044908 CCATGAGGAGGATTTGCAAGGGG - Intronic
1111496583 13:89058393-89058415 CCTTGATGATTATTTTCTTGAGG + Intergenic
1111918876 13:94390011-94390033 CCTTGGGAAGGATTTCCTTGGGG - Intronic
1116534779 14:46015874-46015896 CCTGGAGGAGGAGTTTCTGGAGG + Intergenic
1125131517 15:36289111-36289133 CCTGGGGGAGGAGTTTCTGGAGG + Intergenic
1126552827 15:49952169-49952191 CCTTGGGGTTGATCTTCTCGTGG + Intronic
1128852340 15:70972460-70972482 TCTTGAGGTTGATTTTCTTGAGG + Intronic
1130185663 15:81678888-81678910 TCTTGGGGATGATTTTCTCATGG - Intergenic
1130845298 15:87738510-87738532 CTTTGAGTAGGATCTTCTGGAGG + Intergenic
1137481881 16:48858689-48858711 CCTAAAGGTGGATTTTCTCCTGG + Intergenic
1139836023 16:69839217-69839239 CCTTTATGAGGATTTCCACGGGG - Intronic
1140403981 16:74695460-74695482 CCTTGAAGAGTATTTTGTCCTGG + Exonic
1140539540 16:75744012-75744034 CCTTGATGAGGACTTTTTCAAGG - Intronic
1140955076 16:79856047-79856069 TCTTGGGGTGGATTTTCTAGTGG + Intergenic
1141865205 16:86745491-86745513 CCTTGGGGAGGAGGTTCTGGAGG + Intergenic
1143732473 17:8888865-8888887 CCTTGAGCAGGATTTCCTGCAGG + Exonic
1147464150 17:40597831-40597853 CCCTGTGGAGGATTTTCCCTGGG - Intergenic
1152371469 17:79891127-79891149 CCTGGAGGAGGAGGTTCTGGGGG + Intergenic
1154302482 18:13206594-13206616 AATTGAGGAGGACTCTCTCGGGG + Intergenic
1155464778 18:26122109-26122131 CCTTGGGGATGATCTTCTCATGG - Intergenic
1156908419 18:42381889-42381911 ACTTGAGGATGATGTTCTTGAGG + Intergenic
1158429412 18:57371494-57371516 CCTTGAAGTGGATTTTCAAGAGG + Intronic
1202636049 1_KI270706v1_random:45550-45572 TCTTGGGGATGATCTTCTCGTGG + Intergenic
930658528 2:54030982-54031004 CCTAGAGGATGAGTTTCTTGAGG - Intronic
931850422 2:66246175-66246197 CCTTGGGGAGGAGGTTCTGGAGG - Intergenic
936739834 2:115491583-115491605 CCAGGAGGAGGGTTGTCTCGGGG + Intronic
937267414 2:120625256-120625278 CCTTGGTGAGGACTCTCTCGTGG - Intergenic
937526288 2:122773723-122773745 TCTTGAGGTTGCTTTTCTCGAGG - Intergenic
943232695 2:185275717-185275739 CCTCAAGGATGATTTTCTGGTGG + Intergenic
944363837 2:198892963-198892985 CCTTGGGGATGATCTTCTCATGG - Intergenic
946322074 2:218960120-218960142 CCTTGCGGAGAAGGTTCTCGCGG - Exonic
1169113900 20:3050300-3050322 CCTTGAGCAAGATATTCTCTTGG - Intergenic
1170226239 20:13995022-13995044 TGTTGAGGAGGATTTTCACCAGG - Intronic
1173909731 20:46657754-46657776 CCTTGGGGAGCTTTTACTCGTGG + Intronic
1175615182 20:60392049-60392071 CCTAGGAGAGGATTTTATCGGGG - Intergenic
1178518574 21:33268196-33268218 CCGTGAGGAGAAATTTCTGGAGG - Intronic
1179572634 21:42286942-42286964 CCTTGAGGATGACTTTCCGGTGG + Intronic
1179650368 21:42804493-42804515 CCTGGGGGAGGAGTTTCTGGAGG + Intergenic
1180364668 22:11927685-11927707 TCTTGGGGATGATCTTCTCGTGG - Intergenic
1180721539 22:17912709-17912731 CCTTGAACAGGTTTTTCTGGTGG + Intronic
1181609009 22:24000143-24000165 CTTTGAGGAGTATTTTCTGCAGG - Intergenic
949622563 3:5830908-5830930 CCTTGAGGTGGATCTACTCCAGG - Intergenic
950136936 3:10588024-10588046 CACTGAGGAGTATTCTCTCGTGG + Intronic
951298814 3:20970978-20971000 CCTTGGGGAGGAGGTTCTGGAGG + Intergenic
951469929 3:23045169-23045191 TCTTGAGGATGATCTTCTCATGG - Intergenic
951822607 3:26828935-26828957 TCTTGGGGATGATCTTCTCGTGG - Intergenic
960304740 3:116047130-116047152 GCTTGTGGAGGATTTTCTTGAGG - Intronic
963356756 3:144217663-144217685 AGTTGAGGAGGATGTTCACGTGG + Intergenic
963416110 3:144997968-144997990 TCTTGAGGTTGATTTTCTCATGG - Intergenic
964612057 3:158625404-158625426 GTTTGAGGAGGTTTTTCTCTTGG + Intergenic
968468778 4:766996-767018 CCGTGGGGAGGATTTGCTGGTGG + Exonic
973365858 4:49208947-49208969 TCTTGGGGATGATATTCTCGTGG + Intergenic
973393312 4:49573963-49573985 CCTGGTGGAGGTTTTTCTTGAGG - Intergenic
974085997 4:57262142-57262164 TCTTGGGGATGATGTTCTCGTGG + Intergenic
974965254 4:68752327-68752349 TCTTGAGGTTGATTTTCTCATGG - Intergenic
977075210 4:92442432-92442454 CCTTGGGGAGGAGGTTCTGGAGG + Intronic
978118661 4:105051491-105051513 TCTTGAGGATGATCTTCTTGTGG - Intergenic
979735215 4:124074247-124074269 TCTTGGGGTTGATTTTCTCGTGG - Intergenic
980333461 4:131439529-131439551 TCTTGGTGATGATTTTCTCGTGG + Intergenic
981024655 4:140065298-140065320 CCTTGATGAAATTTTTCTCGGGG - Intronic
981283402 4:142987221-142987243 CCTTGAGGAGGGAGTTCTGGAGG - Intergenic
983585295 4:169348056-169348078 CCTTGGGGAGGTTTTACTCATGG + Intergenic
1202763363 4_GL000008v2_random:131417-131439 TCTTGGGGATGATCTTCTCGCGG + Intergenic
985937793 5:3110086-3110108 CCTGAAGGAGGATTTTCCCTTGG - Intergenic
986915287 5:12612400-12612422 CCTTGGGGTTGATTTTCTTGTGG + Intergenic
988317556 5:29650042-29650064 CCAGGAGGAAGATTTTCTCAAGG + Intergenic
988329692 5:29819273-29819295 ACTTGAGTAGAATTTTCTCAAGG - Intergenic
989615160 5:43331409-43331431 CCTTGAGGAGGAGATCCTTGAGG + Intergenic
991294817 5:65069688-65069710 CCTTGAGAAGGATTTTTTTAAGG - Intergenic
994585876 5:101709037-101709059 CCTTGGGGATGATCTTCTTGTGG + Intergenic
996778458 5:127158577-127158599 CCTTGGGGATGATCTTCTCATGG + Intergenic
997342188 5:133153323-133153345 CAGTGAGGGGGATTTTCTCTTGG + Intergenic
1000140344 5:158397234-158397256 CCATGAGGGAGATTTTCTGGGGG + Intergenic
1000964970 5:167645460-167645482 GATTGAGGGGGATTTTCTGGTGG - Intronic
1004575219 6:16888196-16888218 CCTGGAGGAGGAGGTTCTGGAGG - Intergenic
1004836998 6:19541144-19541166 CCTGGGGGAGGATGTTCTGGAGG - Intergenic
1004853507 6:19725323-19725345 ACTTGAGGAGGATTGTGTCAAGG - Intergenic
1008850218 6:56014285-56014307 CCTTGGGGAGGAGGTTCTGGAGG + Intergenic
1009536843 6:64898120-64898142 CCTTGGGGTTGCTTTTCTCGAGG - Intronic
1010299326 6:74242074-74242096 CCTTGAGGAAGTTTTTTTCTGGG + Intergenic
1013506682 6:110807359-110807381 CCTTTAAGAGGATTTTCTTTTGG - Intronic
1014115346 6:117663156-117663178 CCTGGAGGGGGATGTTCTGGAGG + Intergenic
1016535763 6:145106620-145106642 CCTGGGGGAGGAGGTTCTCGAGG + Intergenic
1016843629 6:148548723-148548745 CCTCGAGGGGGCTTTTCTGGAGG - Exonic
1018005243 6:159615951-159615973 CCTAGAGGAGCATCTTCTCTTGG + Intergenic
1018110192 6:160529506-160529528 TCTTGAGGTGGCTCTTCTCGAGG - Intergenic
1018521473 6:164655622-164655644 CCTGGAGGAGGAGGTTCTGGAGG + Intergenic
1018727587 6:166626212-166626234 CCTTGTGGACGGTTCTCTCGTGG - Intronic
1021206788 7:17790043-17790065 GCTTGAGGATGATGTTCTCATGG - Intergenic
1022561724 7:31356311-31356333 CCTTTAGGAGGCTTTTTTAGGGG + Intergenic
1024525367 7:50344038-50344060 CCTTCTGGAGGATTTTTTGGGGG - Intronic
1030523280 7:110624361-110624383 CATTCAGGAGCATTTTCTGGTGG - Intergenic
1036682043 8:10882367-10882389 CCTTGTGGTGCCTTTTCTCGTGG - Intergenic
1036943341 8:13071712-13071734 CCTGGAGGAGGCTGTTCTGGAGG - Intergenic
1037198596 8:16222539-16222561 TCTTGAGGATGATCTTCTCATGG + Intronic
1038725583 8:30079357-30079379 GCTTTAGGTGGATTTTCTTGTGG - Intronic
1039231835 8:35456974-35456996 ACTTGTGGTGCATTTTCTCGAGG + Intronic
1039319670 8:36414267-36414289 CCTGGAGGAGGATTTACTTTAGG + Intergenic
1041615475 8:59900917-59900939 TCTTGGGGATGATCTTCTCGTGG - Intergenic
1042748183 8:72130374-72130396 CCTTGAAAAGGAATTTCTGGGGG - Intergenic
1043661135 8:82743004-82743026 TCTTGAGAAGTATTTTCTCTTGG + Intergenic
1044119816 8:88381010-88381032 CCTAGAGGAGGGTTTTCACTGGG - Intergenic
1045242277 8:100413044-100413066 CCGTGAGGAGGAATTTCTCTGGG - Intergenic
1045309397 8:100987431-100987453 CTTTGAGGAGTATTTTCATGGGG - Intergenic
1046559279 8:115816847-115816869 CCTGGAGGAGGAGGTTCTAGAGG - Intergenic
1052703186 9:31961832-31961854 ACTTGAGGATGATCTTCTTGTGG - Intergenic
1052888129 9:33668995-33669017 TCTTGGGGATGCTTTTCTCGAGG - Intergenic
1055282857 9:74694883-74694905 GCTGGAGGATGATTTTCTCAAGG - Intergenic
1057377988 9:94542067-94542089 CCTTGGGGAGGAGGTTCTGGAGG - Intergenic
1058095999 9:100861077-100861099 CCTTTAGGAGGATTTTGCTGGGG + Intergenic
1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG + Exonic
1203544122 Un_KI270743v1:116290-116312 TCTTGGGGATGATCTTCTCGTGG + Intergenic
1188865068 X:35304521-35304543 CCTTGACGATAATTTTCTTGAGG + Intergenic
1192334233 X:70204240-70204262 CCTTGGAGAGGATTTTTCCGGGG + Intronic
1193052166 X:77113031-77113053 TCTTGGGGAGGATCTTCTCGTGG - Intergenic
1193719339 X:84970135-84970157 TCTTGAGGTTGATCTTCTCGTGG + Intergenic
1194830470 X:98617715-98617737 TCTTGAGGATGATATTCTTGTGG + Intergenic
1195382794 X:104286580-104286602 CCTTAAGGAAGGTTTTCTGGGGG + Intergenic
1196533544 X:116815933-116815955 CCTGGGGGAGGAGTTTCTGGAGG + Intergenic
1196773857 X:119321234-119321256 CCTGGGGGAGGAGTTTCTGGAGG + Intergenic
1197098162 X:122620319-122620341 CCTTGAGGTTGTTCTTCTCGAGG + Intergenic