ID: 1101996289

View in Genome Browser
Species Human (GRCh38)
Location 12:109527629-109527651
Sequence CTGTGGCCAAGGAGCAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 353}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101996289_1101996295 2 Left 1101996289 12:109527629-109527651 CCGGCCTTGCTCCTTGGCCACAG 0: 1
1: 0
2: 3
3: 34
4: 353
Right 1101996295 12:109527654-109527676 CATTAGTTTGAAAACTTAGAAGG 0: 1
1: 0
2: 2
3: 22
4: 260
1101996289_1101996298 23 Left 1101996289 12:109527629-109527651 CCGGCCTTGCTCCTTGGCCACAG 0: 1
1: 0
2: 3
3: 34
4: 353
Right 1101996298 12:109527675-109527697 GGAACAAAGTGCAGATTGGGAGG 0: 1
1: 0
2: 0
3: 20
4: 205
1101996289_1101996297 20 Left 1101996289 12:109527629-109527651 CCGGCCTTGCTCCTTGGCCACAG 0: 1
1: 0
2: 3
3: 34
4: 353
Right 1101996297 12:109527672-109527694 GAAGGAACAAAGTGCAGATTGGG 0: 1
1: 0
2: 1
3: 17
4: 372
1101996289_1101996296 19 Left 1101996289 12:109527629-109527651 CCGGCCTTGCTCCTTGGCCACAG 0: 1
1: 0
2: 3
3: 34
4: 353
Right 1101996296 12:109527671-109527693 AGAAGGAACAAAGTGCAGATTGG 0: 1
1: 0
2: 3
3: 54
4: 486
1101996289_1101996299 24 Left 1101996289 12:109527629-109527651 CCGGCCTTGCTCCTTGGCCACAG 0: 1
1: 0
2: 3
3: 34
4: 353
Right 1101996299 12:109527676-109527698 GAACAAAGTGCAGATTGGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101996289 Original CRISPR CTGTGGCCAAGGAGCAAGGC CGG (reversed) Intronic
900087815 1:906828-906850 CTGTGGCTAAGGAGAATGCCCGG - Intergenic
900188610 1:1344081-1344103 CCCAGGCCAAGGAGCAAGGCAGG + Intronic
900557032 1:3285736-3285758 CCATGGCCTGGGAGCAAGGCTGG - Intronic
900601614 1:3505196-3505218 CTGTGGCCAAGGTGAGTGGCCGG - Exonic
900803614 1:4752952-4752974 ATGTGGCCAAGGAGCACCCCAGG - Intronic
900895628 1:5481069-5481091 CTGTGGTGAAGGAGCCACGCAGG - Intergenic
900988227 1:6085717-6085739 CTGTGGACAAGGTGCAGGGTGGG - Intronic
901377255 1:8848244-8848266 CTGTGGCCAAGCAGAGAGGCAGG + Intergenic
901690019 1:10966756-10966778 CTGGGGCAAAGGAGGAAGCCGGG - Intronic
901872266 1:12145055-12145077 CTGTGCCCAGGGAGGCAGGCTGG - Intergenic
902893640 1:19463597-19463619 CACTGGCCCAGCAGCAAGGCTGG - Intronic
905975848 1:42173051-42173073 CAGTGGGCAAGGCGCATGGCTGG + Intergenic
906036672 1:42754816-42754838 CTGTTGTCAGGGAGCCAGGCAGG - Intronic
906208444 1:43999315-43999337 CTGTGCCCAGGAAGCCAGGCTGG - Intronic
907191941 1:52656941-52656963 CTGTGGCCATGAAGCAATGATGG - Exonic
907405936 1:54253596-54253618 CTGGGGCCAGGAAGCAGGGCTGG - Intronic
907703628 1:56814062-56814084 CTGTGGCCAAGGGGTAGGGAAGG + Intronic
910581101 1:88825845-88825867 ATGTGGCCAGAGAGGAAGGCAGG - Intronic
912591391 1:110824441-110824463 CTCTGGCAAGGCAGCAAGGCGGG + Intergenic
912848789 1:113103417-113103439 GTATAGCCAAGGAGCAAGGTGGG - Intronic
913465937 1:119142723-119142745 CCTTGTCCAAGAAGCAAGGCTGG - Intergenic
915040429 1:152963723-152963745 CTATAGCCAAGGAGCAGGGTGGG - Intergenic
915527256 1:156483475-156483497 GTGTGCCCAGGGAGCAGGGCTGG - Intronic
916018264 1:160769888-160769910 CTATGGCCAAGAAGCAGGGATGG + Intergenic
916102940 1:161408326-161408348 CTGTGACCAAGGAACAAAACTGG - Intergenic
919774814 1:201187557-201187579 CCGTGGCCAAGGAGGATGGAAGG + Intergenic
919784741 1:201252037-201252059 CCGGGGCCAAGCAGCAAGGCTGG + Intergenic
920952522 1:210585759-210585781 ATATAGCCAAGGAGCAAGGTGGG + Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923465485 1:234244471-234244493 CAGTCTCCAAGGAGCAATGCAGG + Intronic
923545350 1:234919384-234919406 CTGAGGCCCAGGAGCAGTGCTGG + Intergenic
1062972666 10:1660718-1660740 TTGGGGCCAAGGTGCAGGGCTGG - Intronic
1063206688 10:3838723-3838745 CTGATGCCCAGCAGCAAGGCTGG + Intergenic
1064274546 10:13893886-13893908 CAGTGGCCAAGGCGGAAAGCAGG - Intronic
1064826501 10:19408422-19408444 CTGAAGTCAAGGATCAAGGCTGG - Intronic
1066661513 10:37741570-37741592 CTGTGACCTCGGAGCAAGGTTGG + Intergenic
1067465856 10:46498218-46498240 ATGTGGCCAATGGGCAATGCTGG + Intergenic
1067621331 10:47886388-47886410 ATGTGGCCAATGGGCAATGCTGG - Intergenic
1067760425 10:49040899-49040921 CTGTGGCCTAGGATCACAGCAGG + Intronic
1067847600 10:49736276-49736298 CTCTGGCCAATGTGCCAGGCAGG - Intronic
1069819750 10:71220157-71220179 CTGTGGGCTAGGACCATGGCAGG + Intronic
1070971536 10:80571472-80571494 CTCTGGCCAATGAGAAAGCCCGG + Exonic
1072238461 10:93473315-93473337 CTGTGGCCAAGGGGCATGGAAGG - Intronic
1072987027 10:100149823-100149845 CTGTGGCAGAGGGGCAAGGAGGG - Intergenic
1073124364 10:101140444-101140466 CCGCGGCCAGGGAGAAAGGCCGG + Intergenic
1073181104 10:101583785-101583807 CAGTTGCCAAGCAGCCAGGCTGG - Intronic
1073576856 10:104633341-104633363 CTGTGTTCAAGTAGCAAGGTTGG - Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074406406 10:113183668-113183690 CTGTGCACAAGGAGCAAGGCCGG - Intergenic
1074705100 10:116123223-116123245 CTGTGGGCTAGGAGCAGGGATGG - Intronic
1075084989 10:119409016-119409038 CAGGGGGCAAGCAGCAAGGCCGG + Intronic
1075936055 10:126342227-126342249 CAGTGGCCAAGGAGAAAGTGTGG + Intronic
1076279998 10:129238334-129238356 CTGGGGTCAAGGAGCAGGGGAGG - Intergenic
1076366810 10:129926584-129926606 CTGTGGCCAAGTGGCCAGGGAGG + Intronic
1076629019 10:131841710-131841732 GTGGGGCCAGGGAGGAAGGCGGG - Intergenic
1076746659 10:132517969-132517991 CTGGGGACAGGGTGCAAGGCTGG - Intergenic
1077302763 11:1854859-1854881 ATGAGGCCAAGGAGGAAGGCGGG - Intronic
1078682718 11:13494155-13494177 CTGTGCCCAAGAAGCCACGCTGG - Intronic
1080224252 11:29942949-29942971 CTGAGCCCCTGGAGCAAGGCTGG - Intergenic
1080869987 11:36228808-36228830 CTGTGGCCAAGAGGCTGGGCTGG - Intronic
1081744939 11:45466296-45466318 CTCTGGCCATGAAGCATGGCAGG + Intergenic
1081797289 11:45829600-45829622 TTGTTGCTAATGAGCAAGGCAGG + Intergenic
1082207454 11:49455155-49455177 CTGTAGCTAAGGAGGGAGGCAGG + Intergenic
1083221306 11:61254564-61254586 CTGGGGACAAGCAGAAAGGCAGG + Intergenic
1083861626 11:65423124-65423146 CTGTGTGGAAGGAGGAAGGCAGG + Intergenic
1083998444 11:66283651-66283673 CTGCGGCCAAGGGGCAGGGCTGG - Exonic
1084034029 11:66497192-66497214 CTGGGACCAAGGACCAAGCCTGG + Intronic
1084390106 11:68869845-68869867 CTGTGACCAAGGAACAAAACGGG + Intergenic
1084774987 11:71369174-71369196 CGGAGGCCAGGGAGCAGGGCAGG + Intergenic
1084938307 11:72599055-72599077 CTGAGGCCAAGGAGCTGGGCAGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085163186 11:74368088-74368110 CTGTGGCCAAGAAGCAGCTCCGG + Intronic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1086647820 11:89246602-89246624 CTGTAGCTAAGGAGGGAGGCAGG - Intronic
1088069191 11:105760374-105760396 CTGGGGCCAAGGAGAAAAGTTGG - Intronic
1089603803 11:119630120-119630142 CTGTGGTCCAGAAGCAAGGGTGG + Intronic
1092115189 12:5996067-5996089 CTGCAGCCCTGGAGCAAGGCAGG - Exonic
1092968903 12:13672578-13672600 CTGTGGGCAGGGAGGATGGCAGG - Intronic
1094723611 12:33089970-33089992 CTGAGGTGAAGGATCAAGGCAGG + Intergenic
1096616553 12:52836362-52836384 CTGTCTCCAAGCAGCAAGCCGGG - Intergenic
1096622545 12:52873714-52873736 TTGTGGCCCAGGTGCAAGTCAGG + Intergenic
1096630666 12:52924983-52925005 CTGTGGAAAAGGAACAGGGCTGG + Intronic
1097015365 12:55982436-55982458 CTGTGAACAGGGAGGAAGGCAGG + Intronic
1101996289 12:109527629-109527651 CTGTGGCCAAGGAGCAAGGCCGG - Intronic
1102748292 12:115269246-115269268 TTCTGGCCAAGGAGCATGGTTGG - Intergenic
1103688726 12:122753086-122753108 CTGAGGCGAAGGAGCAACCCCGG - Intronic
1103907832 12:124336310-124336332 CTGTGTCCAGGGAGCAGGGATGG - Intronic
1104183825 12:126409064-126409086 CTGGGTCCACAGAGCAAGGCAGG - Intergenic
1104213236 12:126710716-126710738 CAGTGTCTAAGGGGCAAGGCAGG - Intergenic
1104558964 12:129826507-129826529 TTGTGTCCCAGGAGCAAGGCGGG - Intronic
1108573660 13:51772880-51772902 CTGGGGTCAAGGAGCAAAACTGG + Intronic
1108685635 13:52816544-52816566 CTCTGGCCAAACAGCGAGGCTGG + Intergenic
1108693441 13:52881170-52881192 CTGTAGCCCAGGAACATGGCAGG + Intergenic
1110456281 13:75693754-75693776 ATGTGGCCGAGGAGCATGGGTGG + Intronic
1113216269 13:108043945-108043967 CTGTGGCCCAAGAGCACTGCAGG - Intergenic
1113680835 13:112243757-112243779 CTGTGGAGAAGGAGCAGGGCAGG + Intergenic
1115441141 14:33437387-33437409 CTGTGGCCATAGAGAAAGTCAGG + Intronic
1116241246 14:42346060-42346082 CTAGGGCCCAGGAGCAAGTCAGG - Intergenic
1118618916 14:67596816-67596838 TTATAGCCAAGGAGCAAGGTGGG - Intronic
1119001871 14:70889645-70889667 CAGGAGCCCAGGAGCAAGGCAGG + Intergenic
1119698101 14:76730119-76730141 CTGTGGCCAAGGAGAATGGGAGG + Intergenic
1120150812 14:81031691-81031713 CTGTGGGCAAAGTGCCAGGCTGG - Intronic
1121683995 14:95818444-95818466 GTCTGGGCAAAGAGCAAGGCAGG + Intergenic
1121862953 14:97336595-97336617 CTGGAACCAAGGAGCAAGGCTGG + Intergenic
1121909556 14:97776640-97776662 TTATGGCCAAGGAGCAGGGCAGG - Intergenic
1122155358 14:99747332-99747354 CTCTGGCCCAGGAGAAAGGCAGG + Intronic
1122275746 14:100589895-100589917 CTGTGGTCAGGGAGCAGGGCAGG + Intergenic
1123032379 14:105458125-105458147 GTGAGGCCAGGGTGCAAGGCTGG - Intronic
1123106832 14:105845717-105845739 CTGAGGACAAGGGGCAGGGCAGG + Intergenic
1124143712 15:27100893-27100915 CTGAGGACCAGGAACAAGGCAGG + Intronic
1125599968 15:40910099-40910121 CTGTGGCCAAGGATCCACACTGG - Intergenic
1127388662 15:58487853-58487875 CTGTTGCCAAGGAGCATGGTGGG + Intronic
1128702598 15:69815060-69815082 CTCTGTCCAACGAGCAAAGCTGG - Intergenic
1129349981 15:74950275-74950297 AGCTGGGCAAGGAGCAAGGCAGG + Intergenic
1129461963 15:75704121-75704143 CCTGGGCCAAGCAGCAAGGCAGG - Intronic
1129658538 15:77540538-77540560 CTGTGGGCTGGGAGCTAGGCTGG - Intergenic
1129722891 15:77887724-77887746 CCTGGGCCAAGCAGCAAGGCAGG + Intergenic
1129885003 15:79031555-79031577 GTATGGCCGGGGAGCAAGGCAGG + Intronic
1129914711 15:79258706-79258728 CAGTGTCCAGGGAGCAAAGCAGG + Intergenic
1131397488 15:92098088-92098110 TTGTGGGGAAGGAGCAAGGCAGG + Intronic
1131515012 15:93071587-93071609 CTGGGGGCCAGGAGCAGGGCTGG + Intronic
1131825738 15:96321761-96321783 CTGAGGCCGAGGAGGAAGGCAGG - Intergenic
1132603098 16:782608-782630 CTGTGGCCCAGGAGGGAGACAGG + Intronic
1132623569 16:879533-879555 CTGTGGACACGGGGCAGGGCGGG + Intronic
1132631943 16:922179-922201 TTGCTGCCAAGGAGCATGGCTGG - Intronic
1132633907 16:933602-933624 CTGAGGTCATGGAGAAAGGCAGG + Intronic
1132812457 16:1807893-1807915 CTGGGACCTAGGAGCAAGCCTGG - Exonic
1132859548 16:2063256-2063278 ACGTGGCCAAGTAGCAAGGAAGG + Intronic
1134020514 16:10918270-10918292 CTGTGGCCAAGTGGGAGGGCAGG - Intronic
1134023301 16:10936743-10936765 CTGTGGCCAGGGAACCGGGCTGG + Intronic
1136120102 16:28127328-28127350 CGGGTGCCAAGGAGGAAGGCAGG - Intronic
1138206969 16:55132516-55132538 CTGTGGGTAAAGAACAAGGCTGG - Intergenic
1139448350 16:67012497-67012519 TTATAGCCAAGGAGCAAGGTGGG - Intergenic
1139468377 16:67165898-67165920 CTGGGTCGCAGGAGCAAGGCAGG - Intronic
1139592379 16:67940479-67940501 CTGTGGATATGGAGCAAGGTGGG + Intronic
1139592727 16:67942497-67942519 CTGTGGCCAATGAGGAAGACAGG + Exonic
1139959000 16:70706991-70707013 CTGTGGGGCAGGAACAAGGCAGG - Intronic
1141047136 16:80725477-80725499 CTGTGGGCCAGGAGCTATGCTGG - Intronic
1141569069 16:84923194-84923216 ATGTGTCCAAGCAGAAAGGCAGG - Intergenic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1142693010 17:1618172-1618194 GTGTGGCCAAGGAGCCCCGCCGG + Intronic
1142953390 17:3503083-3503105 CTGTGGCCTAAGAGGATGGCGGG - Exonic
1142979494 17:3663457-3663479 CTGTGGCCAAGCAGCAGGGTCGG + Exonic
1143098993 17:4494602-4494624 CTGTCGCCAAGCAGAAAGCCTGG - Intergenic
1143297504 17:5882541-5882563 GTGTGGCCACGGAGGAAGGCTGG - Intronic
1145399118 17:22517051-22517073 CTGTGTCCCAGGAGCTGGGCTGG - Intergenic
1147632723 17:41942590-41942612 CAGGGGCCAAGGAGACAGGCAGG + Intronic
1147820713 17:43240177-43240199 ATGGGGCAAAGGAGCGAGGCTGG - Intergenic
1148465038 17:47859853-47859875 TTGGGGCAAAGGAGCAAGGGCGG + Intergenic
1148698415 17:49574774-49574796 CTGGGCCCAAGGAGCACGGTGGG - Intergenic
1148842522 17:50508255-50508277 CCGTGGCCTAGCAGCAGGGCGGG + Intergenic
1148890004 17:50800434-50800456 CTGAGGCCAAGGACACAGGCAGG + Intergenic
1150483407 17:65527926-65527948 ATGTGGCCAAGGACCTCGGCAGG - Intergenic
1150813786 17:68377210-68377232 CTGAGGCCAAGGAGAATGGAAGG + Intronic
1152004140 17:77667117-77667139 GTGTGGCAAAGCAGCAAGGAAGG + Intergenic
1152320987 17:79608832-79608854 CTTTGGCCGAGGACCGAGGCTGG - Intergenic
1152421599 17:80196204-80196226 CTGTGTGCAAGGCCCAAGGCTGG - Intronic
1152462825 17:80450286-80450308 CCGAGGCCAGGGTGCAAGGCAGG + Intergenic
1152472541 17:80498465-80498487 CTGTGGCCAGGAAGACAGGCCGG - Intergenic
1152521483 17:80859145-80859167 GTGCGGCCTAGGAGCAGGGCTGG + Intronic
1152558222 17:81065224-81065246 CTGTGGCCCAGGAGCAAGCCTGG + Intronic
1153991457 18:10404239-10404261 CTGTGGCCCATGTGCCAGGCTGG - Intergenic
1154284020 18:13034863-13034885 CTGTCGGCAAGGAGGAAGGCAGG - Intronic
1155162329 18:23206138-23206160 CGGTGGGCAGGGAGGAAGGCAGG - Intronic
1155651844 18:28152601-28152623 CGGAGTCCAAGAAGCAAGGCAGG + Intronic
1157113451 18:44842447-44842469 CTGTCCCCAGGGAGCAGGGCTGG - Intronic
1158405801 18:57158127-57158149 CTGTGGCCAAGGAGAGATGCAGG - Intergenic
1160005133 18:75063738-75063760 CTGGGCTCGAGGAGCAAGGCAGG + Exonic
1160315100 18:77836333-77836355 ATGTGGCCAAGGAGCACGCAGGG - Intergenic
1160425034 18:78773619-78773641 CTGGGCCTCAGGAGCAAGGCAGG - Intergenic
1160698312 19:494972-494994 CTGAGGCCCAGGGGCAGGGCTGG - Intronic
1160706924 19:534225-534247 CCGCGGCCACAGAGCAAGGCTGG - Intronic
1163115350 19:15185560-15185582 GTGGGGGCAAGGAGCCAGGCGGG + Exonic
1163696893 19:18768678-18768700 CTGTGGCCCACGAGTCAGGCTGG - Exonic
1163857005 19:19711014-19711036 GGGAGGCCAAGGTGCAAGGCAGG - Exonic
1164618340 19:29679755-29679777 CAGAGGCCAGGGAGCCAGGCGGG + Intergenic
1164903353 19:31946915-31946937 TAGAGGCCAGGGAGCAAGGCAGG + Intergenic
1165037197 19:33042278-33042300 CTGTGGCCAAGGGGGCAGGTGGG - Intronic
1166918000 19:46208944-46208966 CTGTGGGCAAGAAGAGAGGCGGG + Intergenic
1167515195 19:49919264-49919286 CTGTCTCCAGGGAGCAGGGCTGG - Intronic
1168508953 19:56959325-56959347 CTGTAGCCAAGAAGCAGGGTGGG + Intergenic
925262619 2:2541671-2541693 CTGTGGCCCAGCAGCACAGCGGG - Intergenic
925911199 2:8574658-8574680 CTGTGTCCAAGGAGGAAGGCGGG + Intergenic
926420070 2:12687323-12687345 CTGTGGCCATGCAGAGAGGCAGG + Intergenic
927150543 2:20192937-20192959 CTGAGGTCAAGGAGCAAGCTGGG + Intergenic
927720260 2:25377805-25377827 TTGTGGCCCAGGAGAAGGGCAGG + Intronic
927720484 2:25378935-25378957 CTGTGGGAAAGGAGCATGGGAGG + Intronic
927885035 2:26713078-26713100 CTGTGGGCACTGGGCAAGGCAGG + Intronic
928437988 2:31268196-31268218 CAGTGGCCATGAAGCAAGCCAGG - Exonic
929964570 2:46524642-46524664 CTGTGGGCAAGGGGCCAGTCAGG + Intronic
931804384 2:65790155-65790177 CAGTGGACTGGGAGCAAGGCAGG + Intergenic
931875544 2:66507905-66507927 CTGTCCCTACGGAGCAAGGCAGG - Intronic
932692284 2:73923101-73923123 CTGTGGCCAAGGAAGAGGGTTGG - Intergenic
934548183 2:95236050-95236072 CTGTGGGCAAGGAGTCAGGCTGG + Intronic
934940926 2:98501489-98501511 CTGTGTACAACCAGCAAGGCTGG - Intronic
935378142 2:102421570-102421592 CTGCAACCAAGGAACAAGGCAGG - Intronic
937067586 2:119029630-119029652 CGGTGACAAAGGAGAAAGGCAGG + Intergenic
937411960 2:121684414-121684436 CTGTGACCAAGGAACAAAACTGG - Intergenic
937707094 2:124933632-124933654 TTGTGCCCAAGAAGGAAGGCAGG - Intergenic
937815213 2:126243745-126243767 CTCCGGACAAAGAGCAAGGCAGG - Intergenic
938229440 2:129645881-129645903 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229445 2:129645911-129645933 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229450 2:129645941-129645963 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229455 2:129645971-129645993 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229460 2:129646001-129646023 CTGTGGACAAGGAGCCATGCTGG - Intergenic
938229470 2:129646061-129646083 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229475 2:129646091-129646113 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229480 2:129646121-129646143 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229485 2:129646151-129646173 CTGTGGACACGGAGCCATGCTGG - Intergenic
938229495 2:129646211-129646233 CTGTGGCCACGGAGCCTTGCTGG - Intergenic
938444704 2:131367711-131367733 CTGTGGCCCAGCAGAAAAGCTGG + Intergenic
938749246 2:134313001-134313023 CTGTGGCCTCAGAGCAAGGAAGG - Intronic
940897841 2:159097663-159097685 CTGTGGTCAAGGTGCAGGACTGG - Exonic
942450251 2:176104710-176104732 CTGGGGCCAAAGAGCCAAGCGGG + Intronic
945573697 2:211503604-211503626 CTGTGCCCAAGGCGCTATGCGGG - Intronic
946015964 2:216604230-216604252 TTGTAGCCAAGGAGCAGGGTGGG + Intergenic
946016118 2:216605516-216605538 CTGTGGCTATTGAGCCAGGCAGG + Intergenic
946063018 2:216961089-216961111 CTGTGGCCAGGGGCCAGGGCTGG + Intergenic
948433496 2:237936007-237936029 TTGTAGCCAAGGAGCAGGGTGGG - Intergenic
948920730 2:241064761-241064783 CAGTGCCCCAGGAGCAAGGGCGG + Intronic
1169036989 20:2461916-2461938 CTGTGGCCAAGGGTCAAAGAAGG + Intronic
1170033823 20:11969655-11969677 CTGAGGTCAAGCAGCAAGGTGGG - Intergenic
1171236984 20:23535178-23535200 CTCTGATCATGGAGCAAGGCTGG - Intergenic
1172149133 20:32778483-32778505 GTGTGGCCCAGGAGCCACGCAGG - Intronic
1172186604 20:33034923-33034945 CTGTGGCTGGGGAGGAAGGCCGG + Intronic
1172201278 20:33127796-33127818 CAGTGGCCAGGAAGCAAGCCAGG + Intergenic
1172740149 20:37160282-37160304 CTGGGGCCTAAGAGCAGGGCTGG - Intronic
1172778298 20:37420646-37420668 CTGTGGGCAAGGAACGAGGAGGG - Intergenic
1174809277 20:53632035-53632057 TCGTCGCCAAGGGGCAAGGCGGG - Intergenic
1175225490 20:57441704-57441726 TTGGGGCCAAAGGGCAAGGCTGG + Intergenic
1175699051 20:61124033-61124055 GTGTGGCCAAGGATCTTGGCAGG - Intergenic
1177359235 21:20047638-20047660 CTGTGGCCTGAGAGCATGGCTGG - Intergenic
1177760254 21:25395153-25395175 TTATAGCCAAGGTGCAAGGCGGG - Intergenic
1178591716 21:33916429-33916451 TTATGGCCAAGGAGCAGTGCGGG + Intergenic
1178789646 21:35688085-35688107 CTGTGGCCAAGGAAGAACCCAGG - Intronic
1178794030 21:35727001-35727023 CTGTGGGCAAGGAGGAGGGTAGG - Intronic
1178880651 21:36447488-36447510 CTGTGACCAGGGAGGAAGACGGG - Intergenic
1179161232 21:38901063-38901085 CTGGGGCAAAGGAGGAATGCGGG - Intergenic
1179710512 21:43210556-43210578 CTGAGGAACAGGAGCAAGGCAGG + Intergenic
1179805200 21:43832852-43832874 CTGTGGGCAACGGGGAAGGCAGG + Intergenic
1179951446 21:44710969-44710991 ATGTGGGGAAGGAGCAGGGCCGG + Intronic
1182077643 22:27505829-27505851 CTGTATCCTAGGAGTAAGGCTGG - Intergenic
1182089562 22:27584805-27584827 GTGTGGTCCAGGACCAAGGCTGG + Intergenic
1184177460 22:42796340-42796362 TTGTAGCACAGGAGCAAGGCGGG - Intergenic
1184536111 22:45088111-45088133 AGGTGGCCATGGAGCAAGGTGGG - Intergenic
1184686492 22:46098701-46098723 TGGGGGCCAAGGAGCCAGGCAGG + Intronic
1184820442 22:46905742-46905764 CTGTGGGAAACCAGCAAGGCAGG - Intronic
949114876 3:309006-309028 CTGTTGCCAAGGTGCGCGGCCGG + Intronic
949541646 3:5037163-5037185 CTGTGGTCAAGACACAAGGCGGG - Intergenic
951517496 3:23577575-23577597 GGGTGACCAAGGAACAAGGCAGG + Intronic
952422421 3:33144103-33144125 CTGTGGCCCAGGCCCAAGCCTGG - Exonic
953853137 3:46481020-46481042 CTGTGGGCAAGGAGTGTGGCTGG - Intronic
954875660 3:53801480-53801502 CTAGTCCCAAGGAGCAAGGCGGG + Intronic
954993364 3:54860114-54860136 ATGTGGCCAAGCAGAAAGGTTGG + Intronic
955162294 3:56476117-56476139 CTGTGGCCAAGGAGGAAAAGTGG - Intergenic
955345185 3:58155844-58155866 CTGTGGCCATTGAGGAGGGCTGG + Intronic
957292194 3:78292307-78292329 CACAGCCCAAGGAGCAAGGCAGG + Intergenic
958195240 3:90235401-90235423 CTCTGGTCATGGAGCAAGGTTGG + Intergenic
959051324 3:101527475-101527497 TTATAGCCAAGGAGCAAGGTGGG + Intergenic
959584453 3:108013302-108013324 CAGTGGCCAAGGACACAGGCTGG - Intergenic
959842489 3:110994345-110994367 TTATAGCCAAGGAGCAAGGTGGG + Intergenic
960050198 3:113232223-113232245 CAGTGGCCTCGGTGCAAGGCTGG - Intronic
960128390 3:114025809-114025831 GTGTGGCCAAGGATGAAGGGTGG - Intronic
961484984 3:127210140-127210162 CTGTGACCTGGGAGCAAGGGAGG + Intergenic
961674198 3:128555126-128555148 CTGTGGCCTGGGCGGAAGGCAGG + Intergenic
962382555 3:134909411-134909433 CTGTGGCCAAGGCTCAAGCTTGG + Intronic
962605046 3:137026021-137026043 AAGTGGCCAAGCAGCAAGGCTGG - Intergenic
962923712 3:139973283-139973305 ATGTGGCTGAGAAGCAAGGCAGG + Intronic
963774359 3:149423137-149423159 TTATAGCCAAGGAGCAAGGTGGG + Intergenic
964769840 3:160212621-160212643 CTGAGGGCAAGGAGCAGAGCAGG - Intergenic
964969027 3:162537105-162537127 CTGTGGCCATGGACCAGGTCTGG - Intergenic
965986247 3:174757313-174757335 AGGTAGCCAATGAGCAAGGCTGG + Intronic
966219671 3:177538289-177538311 ATCAGGCCAAGGAGCAAAGCTGG - Intergenic
966801535 3:183768626-183768648 CTGTAGCCACAGAGCAGGGCAGG - Intronic
966994993 3:185270739-185270761 CTGTTGCTGAGGAGCAGGGCAGG - Intronic
968719859 4:2193734-2193756 CAGTGACCCAGGAGCAAAGCAGG - Intronic
968816368 4:2823823-2823845 CTGTGGCCAGGGTGCAGGCCGGG - Intronic
968829626 4:2926307-2926329 CTGTGACCAGGTAGGAAGGCCGG + Intronic
969053537 4:4388068-4388090 CTGGGGCCACGGGGCAAGGGAGG - Intronic
969476228 4:7423979-7424001 CTGTGGCTTAGGAGGATGGCAGG + Intronic
969647053 4:8437257-8437279 CTGTGACCAAGGAACAAAACAGG + Intronic
971858265 4:32071617-32071639 CTGTGGCCATGGAGCAAGAGAGG - Intergenic
977301412 4:95271874-95271896 CAGTGAGCAAGGAGGAAGGCAGG - Intronic
977660418 4:99579107-99579129 CTGTGTCCAAGCACCAAGTCAGG - Intronic
978617384 4:110611157-110611179 CTTTGGGCCAGGGGCAAGGCTGG + Intergenic
978741220 4:112140158-112140180 CTGTACCCCAGGAGCTAGGCAGG - Intergenic
979723104 4:123926296-123926318 CTGTGGTGACTGAGCAAGGCGGG - Intergenic
985489050 5:168355-168377 CAGTGGCCGGAGAGCAAGGCCGG - Intronic
987027566 5:13942761-13942783 TTGTAGCCAAGGAGCAGGGCAGG - Intronic
987745578 5:21967498-21967520 CTGTGGCCGAGAAGCAACTCCGG + Intronic
989589793 5:43102750-43102772 CTGTGAGCCAGGAGCAAGTCTGG + Intronic
991219765 5:64199685-64199707 ATGTGGCCAGGGAACTAGGCAGG + Intronic
991765779 5:69977626-69977648 CTGTGGCCGAGAAGCAACTCCGG + Intergenic
991781543 5:70140536-70140558 CTGTGGCCGAGAAGCAACTCCGG - Intergenic
991845014 5:70852697-70852719 CTGTGGCCGAGAAGCAACTCCGG + Intergenic
991873986 5:71140850-71140872 CTGTGGCCGAGAAGCAACTCCGG - Intergenic
992013375 5:72552735-72552757 TCCTGGCCAAGGAGCAAGGATGG + Intergenic
992549838 5:77849934-77849956 CTGTGGCTAAAGATCAAAGCTGG - Intronic
993903048 5:93597101-93597123 CTGTGGCCCAGGACCTGGGCAGG + Intergenic
994240808 5:97418669-97418691 GTGTGGCCAAAGAAAAAGGCAGG + Intergenic
994577635 5:101599825-101599847 TTGTGCCAAAGGAACAAGGCTGG + Intergenic
995050656 5:107699038-107699060 CTGTTGCCATGGAGGAATGCTGG + Intergenic
996213577 5:120840719-120840741 CTGTTGCCCAGGATAAAGGCTGG - Intergenic
996312981 5:122127783-122127805 CTGGGGACAAGGAGCAGGGCTGG + Intergenic
996538719 5:124606769-124606791 CCGTGGCCAAGAATCAGGGCTGG - Intergenic
996590966 5:125147427-125147449 CTGTGGCCGGGGAGGAAGGGAGG - Intergenic
998515476 5:142749928-142749950 CATTGAGCAAGGAGCAAGGCTGG + Intergenic
999494594 5:152084711-152084733 CTCTGGGCAATGAGCAGGGCAGG - Intergenic
1000055248 5:157600467-157600489 CTGTGGCTTAGAAGCAAGTCAGG - Intergenic
1000299250 5:159940490-159940512 TTATGGCCAAGGAGCAGGGTTGG - Intronic
1001712363 5:173789134-173789156 CTGGGGCCAAGGGGAAAGGTTGG - Intergenic
1001924637 5:175627290-175627312 CTGTGGGCACAGAGCAAGTCGGG - Intergenic
1001936195 5:175707727-175707749 AGGTGGCCACAGAGCAAGGCGGG - Intergenic
1003103621 6:3196260-3196282 CAGTGCCCAAGCAGCAGGGCAGG + Intergenic
1003511512 6:6785020-6785042 CTGGGGCCAAGGAACAAGATGGG + Intergenic
1004260630 6:14104520-14104542 CTGGGGCTCAGGAGCAAGGTGGG - Intergenic
1004401051 6:15288982-15289004 CTGGGGGCAAGGAGCAGGGGTGG + Intronic
1004449778 6:15734619-15734641 CTGTGGCCAAGAGGCAATGCAGG - Intergenic
1005010706 6:21332703-21332725 CCCTAGCCAAGGAGCAAGGGGGG + Intergenic
1006578241 6:35061400-35061422 CTGAGGCAGCGGAGCAAGGCGGG - Intronic
1006611857 6:35298774-35298796 CTGGGGGAAAGGAGCAAGGTAGG + Intronic
1006752570 6:36387821-36387843 CTGCGGGCTAGGAGCAGGGCAGG + Intergenic
1007477946 6:42131603-42131625 CTCTGGCCAAGGAGCAGCTCTGG + Intronic
1007716100 6:43857205-43857227 CTGCTGCAAAGGAGCAGGGCGGG - Intergenic
1008583112 6:52924100-52924122 CTGTGACCAAGGAACAAAACTGG + Intergenic
1009930910 6:70176625-70176647 CTGTGGCCAGGGATCAAGACAGG + Intronic
1010995844 6:82531571-82531593 CTGTGGCCTATGAGCAAGTGAGG + Intergenic
1016009732 6:139126897-139126919 TTGTAGCCAAGGAGCAGGGGTGG + Intergenic
1016614340 6:146029030-146029052 CTGTGGTCACTGAGGAAGGCGGG - Intronic
1018093159 6:160362880-160362902 CCGCGGCCAAGGAGCCAGGAGGG + Intronic
1018194352 6:161341943-161341965 ATGTGACCAAGGAGCAAGAGAGG - Intergenic
1018859821 6:167703623-167703645 ATGTGGCCAGTGAGGAAGGCAGG + Intergenic
1019164790 6:170091103-170091125 CAGGGGGCAGGGAGCAAGGCCGG - Intergenic
1019661750 7:2228065-2228087 CAGGGGCCAGGGACCAAGGCTGG + Intronic
1023106916 7:36771642-36771664 GTGTGGCCAAGGAAGGAGGCTGG - Intergenic
1023117363 7:36875592-36875614 CAGTGGCCACTGAGCAAGGCTGG - Intronic
1023662353 7:42482885-42482907 CTGGTGACAGGGAGCAAGGCTGG - Intergenic
1025199917 7:56955783-56955805 GTGGGCCCAAGGACCAAGGCTGG + Intergenic
1025672029 7:63621149-63621171 GTGGGCCCAAGGACCAAGGCTGG - Intergenic
1026883053 7:73919753-73919775 CTGGGGCCAGGGTGGAAGGCAGG - Intergenic
1027612402 7:80377686-80377708 CTGTGGCCAAGGGTCAAAGACGG + Intronic
1028713277 7:93935643-93935665 CAGTGGCCAAGGGCAAAGGCCGG - Intergenic
1032019612 7:128400042-128400064 CTGTGGACAGGGAGTCAGGCTGG + Intronic
1032086081 7:128884633-128884655 CTGTGGCCAGGAGACAAGGCAGG - Intronic
1032761052 7:134942171-134942193 CTGCAGCCAAGGAACAAGCCCGG - Intronic
1034826465 7:154269449-154269471 CTGTGGCCCAGGAGAAGGGCAGG - Intronic
1035555287 8:563044-563066 CTATAGCCAAGGAGCAGGGTCGG + Intergenic
1035572491 8:682035-682057 CTGTAGCCAAGGGGCAGGGTGGG - Intronic
1035695789 8:1594861-1594883 CTGTGCCCAGGGGGCATGGCTGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1038431591 8:27504691-27504713 CTGTTGTCAAGGAGGAAGGAGGG + Intronic
1038713513 8:29971411-29971433 CTGTGGCCAAGAAGACAGACTGG + Intergenic
1040588408 8:48765736-48765758 CAGGGGCCCAGGAGCAAGGATGG + Intergenic
1042341546 8:67684956-67684978 GTATAGCCAAGGAGCAGGGCAGG - Intronic
1043152756 8:76739118-76739140 CAGTGACTAAGGTGCAAGGCTGG + Intronic
1045852628 8:106721123-106721145 GTGTGGTCAAGCAGCAAGACTGG - Intronic
1046821640 8:118639992-118640014 CTGTGCCTAAGGAGCAGGGTAGG - Intergenic
1047438778 8:124858022-124858044 CTGATGCCAAGGAGCAAGTGAGG - Intergenic
1047895901 8:129365901-129365923 CTGGGGCCAAGGAGAACTGCTGG - Intergenic
1048134011 8:131728373-131728395 CTGTGGTCAAGCAGCAAGGGAGG + Intergenic
1048606299 8:135971998-135972020 CTGTGAGCAAGGAGCATTGCAGG - Intergenic
1048844965 8:138597404-138597426 GAGTGGCCAAGTAGCCAGGCAGG - Intronic
1048976290 8:139674770-139674792 CTGGGGCCTAGCAGCAAGACAGG + Intronic
1051417036 9:16852881-16852903 CTGTGGAAAATCAGCAAGGCTGG + Intronic
1054531257 9:66184784-66184806 CTGTGGCCGGGGAGACAGGCAGG + Intergenic
1055211407 9:73798916-73798938 CTAAGGTCAAGGAGCCAGGCTGG + Intergenic
1056716936 9:89039238-89039260 CTGTGTGCTAGGAGCAATGCTGG - Intronic
1057181366 9:93032581-93032603 CTGAGGGCAGAGAGCAAGGCTGG - Intronic
1057903409 9:98966436-98966458 CTGGGGCCATGGGGCAAGGTAGG - Intronic
1057912507 9:99031100-99031122 CTGTGGCAAAGGAGCCAGCAGGG - Intronic
1059883827 9:118722177-118722199 CTGTGCCCAAGCAACAGGGCAGG + Intergenic
1060056724 9:120420418-120420440 CTGGGGCCTTGGAGCCAGGCAGG - Intronic
1060231427 9:121828113-121828135 CTGTGGACAAAGAGTAAGGGTGG - Intronic
1061514942 9:131083739-131083761 TTGTGTACAAGGAGCAAAGCAGG + Intronic
1062109447 9:134773955-134773977 CTGTGCCCAGGGAGGAGGGCTGG - Intronic
1062292622 9:135803721-135803743 CTGTGGGGAAGGGGCAGGGCAGG + Intergenic
1062503154 9:136859817-136859839 CTGGGGCTAAGGAGGAAGCCTGG - Intronic
1062567188 9:137168518-137168540 CCGTGCCCAAGGTGCAGGGCAGG - Exonic
1185557006 X:1029464-1029486 GGGTGTCCAAGGATCAAGGCAGG + Intergenic
1186189287 X:7053245-7053267 CTGCTTCCAAGGAGCAAGACAGG + Intronic
1186793542 X:13022619-13022641 CTGAGACCACAGAGCAAGGCAGG + Intergenic
1186858844 X:13651719-13651741 TTATAGCCAAGGAGCAAGGTAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188269421 X:28120261-28120283 GTGGGGCTAAGGAACAAGGCTGG - Intergenic
1190764332 X:53463521-53463543 CTCTGTCCAAGGTGTAAGGCTGG + Intergenic
1190775990 X:53552679-53552701 CTGTGGCGGAAGTGCAAGGCAGG - Exonic
1196175969 X:112639297-112639319 CTCTGGCAAAGGAGCCTGGCAGG - Intronic
1199735876 X:150686231-150686253 CTGGTGCCCAGGAGAAAGGCCGG - Intergenic
1199875506 X:151924638-151924660 CTGTGGGGAAGGGGCAGGGCTGG + Exonic
1199982924 X:152930727-152930749 GTGTGGCCAGGGAGGTAGGCAGG + Intronic
1200134603 X:153868780-153868802 CAGTGGCCAGGGAGCCAGGGAGG - Intronic