ID: 1101996350

View in Genome Browser
Species Human (GRCh38)
Location 12:109527940-109527962
Sequence TGCCAGGTGTTGCAGCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101996343_1101996350 -4 Left 1101996343 12:109527921-109527943 CCCCTGAGAGGACACGCATTGCC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1101996350 12:109527940-109527962 TGCCAGGTGTTGCAGCTTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 225
1101996345_1101996350 -6 Left 1101996345 12:109527923-109527945 CCTGAGAGGACACGCATTGCCAG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1101996350 12:109527940-109527962 TGCCAGGTGTTGCAGCTTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 225
1101996340_1101996350 4 Left 1101996340 12:109527913-109527935 CCTGCCACCCCCTGAGAGGACAC 0: 1
1: 1
2: 1
3: 47
4: 734
Right 1101996350 12:109527940-109527962 TGCCAGGTGTTGCAGCTTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 225
1101996342_1101996350 -3 Left 1101996342 12:109527920-109527942 CCCCCTGAGAGGACACGCATTGC 0: 1
1: 0
2: 0
3: 11
4: 54
Right 1101996350 12:109527940-109527962 TGCCAGGTGTTGCAGCTTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 225
1101996344_1101996350 -5 Left 1101996344 12:109527922-109527944 CCCTGAGAGGACACGCATTGCCA 0: 1
1: 0
2: 1
3: 9
4: 75
Right 1101996350 12:109527940-109527962 TGCCAGGTGTTGCAGCTTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 225
1101996341_1101996350 0 Left 1101996341 12:109527917-109527939 CCACCCCCTGAGAGGACACGCAT 0: 1
1: 0
2: 1
3: 10
4: 71
Right 1101996350 12:109527940-109527962 TGCCAGGTGTTGCAGCTTGGGGG 0: 1
1: 0
2: 0
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101996350 Original CRISPR TGCCAGGTGTTGCAGCTTGG GGG Intronic
900744295 1:4350879-4350901 TGCCTGGAGATGCAGGTTGGAGG - Intergenic
901712253 1:11124946-11124968 TCCCAGGTGATGCGGCTTGTAGG - Intronic
902064916 1:13677056-13677078 TGGGAGGTGTTGGATCTTGGGGG - Intergenic
903276077 1:22222683-22222705 TTCCAGGTGTCCCAGCTTGGAGG + Intergenic
904370203 1:30043413-30043435 TGCCAGCTGCTGCAGCGAGGTGG - Intergenic
904836009 1:33336831-33336853 TGACAGGTGTTGCAGCCAGATGG + Intronic
907545725 1:55258382-55258404 GGGCAGATGTTGCAGGTTGGGGG + Intergenic
907622520 1:55995951-55995973 TTGCTGGTTTTGCAGCTTGGGGG - Intergenic
907787681 1:57628749-57628771 TTCCAGGTGTTACAGCTTATTGG + Intronic
907806347 1:57824208-57824230 AGCCAGGATTTGAAGCTTGGTGG + Intronic
908802751 1:67897319-67897341 AGGCAGGAGTTTCAGCTTGGTGG - Intergenic
909866906 1:80685534-80685556 TGTCAGGGGTTGAGGCTTGGAGG - Intergenic
910301809 1:85714386-85714408 TTGCTGGTTTTGCAGCTTGGGGG - Intergenic
912449424 1:109760115-109760137 GGCCAGGTGAGGCAGCTGGGTGG + Intronic
913996272 1:143653843-143653865 TGGCAGGTGTCGCAGGTTGCAGG - Intergenic
914376549 1:147078074-147078096 TGGCAGGTATTGCAGGTTGCAGG + Intergenic
914492832 1:148162795-148162817 TGGCAGGTGTCGCAGGTTGCAGG - Intergenic
914705462 1:150166448-150166470 TGCCACGTGCTCCAGCCTGGGGG - Intergenic
915460547 1:156068180-156068202 TCCCGGGTGTTCCAGCTTGACGG + Intronic
915649819 1:157301550-157301572 AGGCAGGGGTTGGAGCTTGGAGG - Intergenic
916343808 1:163765972-163765994 TGGCAGGTGTTGGATCATGGGGG - Intergenic
919383335 1:196886461-196886483 TTGCTGGTTTTGCAGCTTGGGGG - Intronic
920062256 1:203235418-203235440 TTGCTGGTTTTGCAGCTTGGGGG + Intronic
923459520 1:234196325-234196347 TGCCCAGGGTAGCAGCTTGGAGG - Intronic
1063496876 10:6518035-6518057 TGCCAGGAGTTGCAGCAGGGAGG + Intronic
1063679362 10:8172238-8172260 TGCCATGTGGGGGAGCTTGGGGG + Intergenic
1064233969 10:13556160-13556182 TGCCAAGAGAAGCAGCTTGGAGG + Intergenic
1065360524 10:24885042-24885064 TGCCTGGGCTTGCAGCCTGGAGG + Intronic
1066156489 10:32683909-32683931 TGGCACGTGTTGCATGTTGGAGG + Intronic
1069994823 10:72335741-72335763 TGCCAGGAGTTGCAGGGTGGAGG + Exonic
1070537101 10:77387479-77387501 TGCCATGAGTGCCAGCTTGGAGG - Intronic
1070974812 10:80597868-80597890 TGGCACGTGTTGCAGTGTGGTGG + Intronic
1073919567 10:108443364-108443386 TGCCAGCTGTTGAAACTTGAGGG + Intergenic
1077195421 11:1277419-1277441 TGCCTGGGGTTGCTGTTTGGGGG - Intronic
1078187594 11:9065628-9065650 TGCCAAGTCTTACAGCTAGGTGG + Intronic
1078876617 11:15405182-15405204 TTCCAGCTGTTGCAGCATGAGGG + Intergenic
1080230796 11:30016632-30016654 CTCCAGCTGTTGCAGCTTGAGGG - Exonic
1081519893 11:43871684-43871706 AGCCAGGTGTGGCAGCCAGGAGG + Intergenic
1083758679 11:64804424-64804446 TGCCGTGAGTTGCAGCTTGATGG + Exonic
1084091018 11:66879430-66879452 TGTCAGGTGTTGCAGAGAGGGGG + Intronic
1086388710 11:86338183-86338205 TGCCAGGGGTTGAAGAGTGGAGG - Intronic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1088120169 11:106359979-106360001 TGCCAGGGGCTGCAGTTGGGGGG - Intergenic
1088531509 11:110815752-110815774 TCCCAGATGATTCAGCTTGGAGG + Intergenic
1091254755 11:134173529-134173551 GGCCAGGGGCTGCAGCATGGTGG - Intronic
1092255730 12:6926010-6926032 TGGGAGATGTTGCCGCTTGGTGG + Intronic
1092262612 12:6960510-6960532 GGACAAGTGTTGCAGCTGGGGGG + Intronic
1095363447 12:41373049-41373071 TTGCTGGTTTTGCAGCTTGGGGG - Intronic
1095363720 12:41375904-41375926 TGCCAGGGGATGGGGCTTGGGGG - Intronic
1100499841 12:95163195-95163217 TGGCTGGAGTTGCAGCGTGGTGG - Intronic
1101989870 12:109476193-109476215 TACCAGGTGTTGCTGCTGGTGGG + Intronic
1101996350 12:109527940-109527962 TGCCAGGTGTTGCAGCTTGGGGG + Intronic
1102193868 12:111010233-111010255 TGCCAGGGGCTGCAGGGTGGTGG + Intergenic
1103359816 12:120346905-120346927 TTCCAGGGCTTGCAGCCTGGTGG - Intronic
1104996166 12:132658710-132658732 GGCCAAGTGTTGAAGCTTGATGG - Intronic
1105995928 13:25671899-25671921 TGCCGGTTTTTGCAGCTTGTGGG + Intronic
1107688105 13:42924476-42924498 TGCCAGGTGTTCCACATTGCAGG + Intronic
1108039306 13:46324496-46324518 TGCCAGGTGCTGTCGCTGGGAGG + Intergenic
1108094967 13:46891954-46891976 TACCATGTGCTGTAGCTTGGAGG - Intronic
1108294683 13:49001971-49001993 TGGCTGGTTTTGCGGCTTGGGGG + Intronic
1109760166 13:66817750-66817772 TGCCAGCTGTTAATGCTTGGAGG - Intronic
1114157248 14:20118665-20118687 TTGCTGGTTTTGCAGCTTGGGGG - Intergenic
1115958752 14:38810874-38810896 TTGCTGGTTTTGCAGCTTGGGGG - Intergenic
1117128384 14:52657229-52657251 TGCCCAGAGTAGCAGCTTGGAGG - Intronic
1117637370 14:57758713-57758735 TGCCAGGTGTTGTAAATTGTTGG + Intronic
1117930979 14:60839810-60839832 TGCCAGCTGCTGCAGCAGGGTGG - Intronic
1118807040 14:69246801-69246823 TGCCAGGTGTTGTAGATGGGAGG + Intergenic
1120692488 14:87607904-87607926 TGTCAGGTGTTGAAACTTAGTGG + Intergenic
1121495764 14:94390546-94390568 TGCCAGGAATTCCAGGTTGGAGG - Exonic
1123485460 15:20731829-20731851 TGACAGCTTTTGCAGCTTGTTGG + Intergenic
1123541946 15:21300877-21300899 TGACAGCTTTTGCAGCTTGTTGG + Intergenic
1127676321 15:61242718-61242740 TTGCTGGTTTTGCAGCTTGGGGG - Intergenic
1130276053 15:82476898-82476920 GGGCAGGTGTTGCAGCTTGTGGG - Intergenic
1130468413 15:84204289-84204311 GGGCAGGTGTTGCAGCTTGTGGG - Intergenic
1130485333 15:84395461-84395483 GGGCAGGTGTTGCAGCTTGTGGG + Intergenic
1130495853 15:84469253-84469275 GGGCAGGTGTTGCAGCTTGTGGG + Intergenic
1130564199 15:84980859-84980881 TGCCCGGTGCTGTAGCTTTGCGG + Intronic
1130590706 15:85208887-85208909 GGGCAGGTGTTGCAGCTTGTGGG - Intergenic
1131328514 15:91472388-91472410 TGCCAGGTGTTAGGGGTTGGGGG - Intergenic
1132098012 15:99002352-99002374 TGCCAGGTGTTTGAGATGGGAGG + Intronic
1132299860 15:100768743-100768765 TGCCAGGTGTTGCTTCCTGATGG + Intergenic
1202950265 15_KI270727v1_random:28019-28041 TGACAGCTTTTGCAGCTTGTTGG + Intergenic
1134021628 16:10925048-10925070 TGTCAGGTGGGGCAGCTTGAGGG + Exonic
1135274023 16:21095525-21095547 TGCCAGGGGTTACAACTGGGGGG + Intronic
1135813471 16:25610736-25610758 TGCTAGTTTTTGCAGCTTGTGGG - Intergenic
1138966895 16:62095400-62095422 TGCCAGGAGTTGGGGCATGGAGG - Intergenic
1139517151 16:67458883-67458905 TGCCAGGAGATGGAGCTGGGGGG - Intronic
1140460476 16:75135629-75135651 TGCCAGGTGTTCAAGGTGGGAGG + Intergenic
1142264097 16:89055623-89055645 TTCCAGGGGTAGCAGCCTGGTGG - Intergenic
1142880386 17:2878854-2878876 CGCAAGGTGCTGCAGCTTGCTGG + Intronic
1146352251 17:32104521-32104543 TGCCAGGAGTTGCTAATTGGTGG + Intergenic
1146688583 17:34857586-34857608 TGACAGGAGAGGCAGCTTGGAGG + Intergenic
1149559640 17:57599367-57599389 AGACAGTTGTTGGAGCTTGGGGG + Intronic
1150952926 17:69822584-69822606 TGCCAGGTGCTGCAGTGGGGTGG - Intergenic
1151797002 17:76353345-76353367 TCCCCGGTTTTGCAGCTGGGAGG - Intronic
1152119306 17:78408496-78408518 GGCCAGGTGAGGCACCTTGGTGG + Intronic
1152641591 17:81451689-81451711 GGCCAGGTGCTGCAGGTTGAAGG - Exonic
1153167387 18:2278257-2278279 TGCCAGGGGATGGAGGTTGGGGG - Intergenic
1154306071 18:13231965-13231987 TCCCAGGGATGGCAGCTTGGTGG + Intronic
1155022104 18:21905964-21905986 TGACAGGGGTTACAGCTGGGAGG + Intergenic
1155550600 18:26961101-26961123 TGCCTGGAATTGCAGCTGGGAGG + Intronic
1156027227 18:32669155-32669177 GGCCTGGTGTGGAAGCTTGGTGG + Intergenic
1156518272 18:37699247-37699269 TTCCAGGTGGAGCATCTTGGAGG + Intergenic
1157021861 18:43792808-43792830 TGCAAGGTGTTTCAGCTGTGTGG + Intergenic
1158559395 18:58500909-58500931 TGCCAGGTCCTGCAGGTTTGTGG - Intronic
1158571219 18:58598371-58598393 TTCCAGGTGATGGAGCCTGGAGG + Intronic
1158709350 18:59823721-59823743 TCCCAGGCGTTGCATTTTGGTGG + Intergenic
1159085123 18:63781419-63781441 TGCCAGGTGTTGCAGATGCCAGG - Intronic
1160195650 18:76753053-76753075 TTCCAGGTGATGAAACTTGGAGG + Intergenic
1161785173 19:6320197-6320219 GGCCAGGTGTTGCTGGTGGGAGG - Intronic
1163516990 19:17770717-17770739 TGCCAGGTGATGGGGCCTGGGGG + Intronic
1163567296 19:18059219-18059241 TGCGGGGTCTTGTAGCTTGGAGG - Exonic
1166319094 19:42005532-42005554 GGCCTGGTTTTGCAGGTTGGGGG + Intronic
1166872853 19:45881450-45881472 TGGCAGCTGATGCAGCCTGGGGG + Intergenic
1167002603 19:46755122-46755144 TGCCAGGGGTTGCAGGCAGGGGG - Intronic
1167212427 19:48141619-48141641 TTAGAGGTGGTGCAGCTTGGTGG - Intronic
1167373966 19:49101551-49101573 TGTCAGGTGTGGCAGGGTGGGGG - Intronic
1168315759 19:55484177-55484199 GGCCAGGAGCTGCAGCGTGGCGG - Exonic
925269577 2:2592688-2592710 TGCATGGTGTTGAAGCTTGCAGG - Intergenic
926121463 2:10243374-10243396 GGCCAGGAGTCGCAGCCTGGTGG + Intergenic
929788659 2:45009037-45009059 TGCGAGGTGCTGCAGCAGGGCGG - Exonic
929873809 2:45779442-45779464 TGCCAGGTGTTGTGGGTTGAGGG + Intronic
932907356 2:75768249-75768271 AGCCAGGTGCTGCAGATTTGAGG - Intergenic
933598510 2:84306242-84306264 TTGCTGGTTTTGCAGCTTGGGGG - Intergenic
934145533 2:89089558-89089580 TGACAGGTGTTGGAGCTCTGGGG - Intergenic
938872840 2:135499089-135499111 TTGCTGGTTTTGCAGCTTGGGGG + Intronic
939649988 2:144748053-144748075 TTGCCGGTTTTGCAGCTTGGGGG + Intergenic
940801744 2:158140370-158140392 TGACAGGACTTGTAGCTTGGAGG - Intergenic
941474400 2:165931830-165931852 TCCCAAGTTTTCCAGCTTGGTGG + Exonic
942402114 2:175613931-175613953 TGCCAGGGGCTGCAGGGTGGGGG - Intergenic
945648809 2:212536292-212536314 TGCCAGGTGCGGCAGGGTGGGGG + Intronic
948381045 2:237550229-237550251 TGCCAGGTGTTGCAGGGAGGCGG - Intronic
948809882 2:240469026-240469048 GGCCAGGGGATGCAGCCTGGGGG + Intergenic
948942372 2:241202931-241202953 TGCCAGGTGTCCCACCTTGCTGG + Intronic
1169546089 20:6652516-6652538 TGCCAGGAGTTGGAGGTTGTGGG - Intergenic
1170369087 20:15628720-15628742 TCCCAGGTCTGGCACCTTGGTGG + Intronic
1171020494 20:21580402-21580424 TGCCAGTTGTGGCATCTGGGTGG - Intergenic
1171492425 20:25530688-25530710 TTGCTGGTTTTGCAGCTTGGGGG - Intronic
1173469919 20:43315175-43315197 TTCCAGGTGTTGCAGCTGCAAGG - Intergenic
1173666726 20:44768365-44768387 TGCCAGGGGCTGCAGCCTTGCGG + Intronic
1174135627 20:48376891-48376913 TGAAAGGGGCTGCAGCTTGGTGG - Intergenic
1175375555 20:58521244-58521266 TGCAGGGTGTTGGAGCTGGGAGG + Intergenic
1177827625 21:26101913-26101935 TGTCAGGTGTTGCTGAGTGGCGG - Intronic
1179453015 21:41478331-41478353 TGCCAGGTGCTGCATTTCGGGGG - Intronic
1179527755 21:41994751-41994773 TGCCAGGTGATGCGGTTTGGTGG + Intronic
1180087911 21:45516316-45516338 TGCCAGGTGGTGGAGGTCGGGGG - Intronic
1181311302 22:21946310-21946332 TGCCAGGAGCAGCAGCTGGGTGG + Intronic
1181377241 22:22469326-22469348 TTGCTGGTTTTGCAGCTTGGGGG + Intergenic
1182461972 22:30489738-30489760 TGCCTGGTGTTCCAGCTTCAGGG - Exonic
1183049901 22:35252376-35252398 TGCCAGGAGCTGGAGCATGGGGG - Intergenic
1184732816 22:46380296-46380318 GGCCAGGTGTGGCCTCTTGGGGG + Intronic
1185301855 22:50085200-50085222 TGTCAGGTGTTGCACCTGGAGGG - Intronic
950464782 3:13146984-13147006 TGCCAAGTGCTGGAGCTTTGAGG - Intergenic
950470793 3:13185044-13185066 TGCCAGGGGTTTCAGATTCGGGG + Intergenic
950537092 3:13584988-13585010 TGCCAGGTGGGCCAGCTTGGTGG - Intronic
951484210 3:23193937-23193959 TGGCTGGTGGTGCAGCTTGGAGG - Intergenic
956989872 3:74751152-74751174 TGCCAGCTGCTGCAGCAGGGCGG + Intergenic
957845059 3:85721556-85721578 TGCCAGGTGCTCCAGCAGGGCGG + Intronic
959552207 3:107674589-107674611 TGGCAGCGGTTGCAGCCTGGCGG + Intronic
961575345 3:127831473-127831495 AGTCAGGGGTGGCAGCTTGGGGG + Intergenic
966603644 3:181800311-181800333 TGCCAGGAGTCCCAGCTAGGTGG + Intergenic
967117187 3:186352622-186352644 TCCCAGGTGTAGGAGCCTGGTGG + Intronic
968762427 4:2449584-2449606 TGCCAGGGCTGACAGCTTGGTGG - Intronic
969272863 4:6114564-6114586 TCCCAGATTTTGTAGCTTGGAGG - Intronic
970483077 4:16497285-16497307 TGCCAGATGTTTTACCTTGGTGG - Intergenic
971092525 4:23361582-23361604 CGCCAGTTGTTGCAGCGGGGTGG - Intergenic
972038184 4:34553876-34553898 TTGCTGGTTTTGCAGCTTGGGGG - Intergenic
973943740 4:55936407-55936429 TTGCTGGTTTTGCAGCTTGGGGG + Intergenic
974199483 4:58620467-58620489 TTGCTGGTTTTGCAGCTTGGGGG + Intergenic
974258025 4:59487525-59487547 TGCCAGGTTTTATACCTTGGGGG + Intergenic
975039812 4:69732140-69732162 TGCAAGGTTTTGCAGCTGTGTGG + Intronic
976437474 4:85034435-85034457 TTGCTGGTTTTGCAGCTTGGGGG + Intergenic
978436643 4:108692772-108692794 CTCCATGTGCTGCAGCTTGGCGG + Intergenic
979970058 4:127123734-127123756 TTACTGGTTTTGCAGCTTGGGGG - Intergenic
980210502 4:129781551-129781573 TGCCAGATGTGGCAGGGTGGGGG + Intergenic
981655618 4:147109425-147109447 TGCCAGGCCTTGCAGCTAGGTGG - Intergenic
982829091 4:160038246-160038268 TGCCAGGTGCTGAGGCTAGGGGG + Intergenic
984830891 4:183971925-183971947 TGCCAGGTGATACAGTTTAGTGG - Intronic
987197785 5:15544576-15544598 TGGCATGTGTGGCAGGTTGGGGG - Intronic
987967005 5:24890614-24890636 TGTCAGCTGTTTCAGCTTTGTGG - Intergenic
988450068 5:31332907-31332929 TGTCAGGGGTTGAAACTTGGAGG + Intergenic
989279067 5:39621122-39621144 TGCCAGCTGCTGCAGCAGGGCGG + Intergenic
993919600 5:93784299-93784321 TGGGAGGTGTTACAGGTTGGTGG + Intronic
993931680 5:93949070-93949092 TGGAAGGTGTTGCAGCTTCAGGG - Intronic
997762885 5:136466994-136467016 TGCCAGGAGTTGCAGCATGTGGG - Intergenic
998138113 5:139685039-139685061 GGGGAGGTGTTGCAGCTGGGGGG + Intergenic
998154924 5:139780223-139780245 TGTCAGATGCTGCACCTTGGTGG + Intergenic
998331129 5:141328203-141328225 TGCCAGGAGTTGCAGCCAAGTGG + Intergenic
999091321 5:148938706-148938728 TTCCAGGAGTTACAGCCTGGAGG - Intronic
1001521555 5:172397492-172397514 TTGCTGGTTTTGCAGCTTGGGGG + Intronic
1002651628 5:180700831-180700853 TTGCTGGTTTTGCAGCTTGGGGG + Intergenic
1006501809 6:34464183-34464205 TGTTAGGTGTTGGAGCCTGGGGG - Intergenic
1006756691 6:36422384-36422406 TGTCAGGGGTTGCATCTTGAGGG + Intronic
1007240111 6:40418682-40418704 TGCAAGGTCTCACAGCTTGGAGG - Intronic
1007639415 6:43325900-43325922 TGCCAGGGGCTGCAGGTAGGTGG + Intronic
1008670110 6:53759551-53759573 TTCCAGGAGTTACAGCCTGGAGG + Intergenic
1009610050 6:65930318-65930340 TGCCAGCTGCTGCAGGCTGGTGG + Intergenic
1016076649 6:139804400-139804422 TGCCAGCTGCTGCAGCTGTGTGG + Intergenic
1018128301 6:160703434-160703456 TGCCAGAAGCTGCAGATTGGGGG - Intronic
1018395675 6:163376409-163376431 TCCCAGGTGTGGCAGCTGGACGG - Intergenic
1019745598 7:2698922-2698944 TGGCAGGTCTTGCAACTTGACGG + Intronic
1023107934 7:36781134-36781156 TGCCTGGTTTTGCAGCTTTTAGG - Intergenic
1023939338 7:44759900-44759922 CGCCGGGTGGTGCAGCTTGGGGG + Intronic
1024318230 7:48041110-48041132 TGCCAGTGGTGGCATCTTGGTGG + Intronic
1026625106 7:71985103-71985125 TGCCAGGTTTTTCAATTTGGTGG - Intronic
1026919456 7:74144504-74144526 TTCCAGGTTTTTCAGCTTGAGGG - Intergenic
1027704340 7:81510310-81510332 TGCCAGCTGCTACAGCGTGGTGG + Intergenic
1027793197 7:82658620-82658642 TTGCTGGTTTTGCAGCTTGGGGG - Intergenic
1029195945 7:98805523-98805545 TGCATGGGGTTGCATCTTGGGGG + Intergenic
1029458497 7:100682767-100682789 TGCCATCTGTAGCAGCTTGGGGG - Exonic
1032319596 7:130874093-130874115 AGCCAGGGGCTGCAGGTTGGAGG + Intergenic
1032520403 7:132539402-132539424 TCCCAGGTGTTGCTGCTCTGGGG - Intronic
1033474580 7:141679229-141679251 AGAAAGGTTTTGCAGCTTGGTGG - Intronic
1033485946 7:141789391-141789413 TACCAGGCCTTGCAGCTTGGTGG + Intergenic
1035112761 7:156497116-156497138 TGGTAGATGTTGCAGCTTAGGGG + Intergenic
1036687200 8:10919544-10919566 TGCCAGGTGATGCACTGTGGAGG + Intronic
1038489356 8:27958676-27958698 TGCCAGGTATTGCAGTCTGCTGG - Intronic
1038696559 8:29811984-29812006 TGCCTGGTGTTCCAGCTCAGTGG + Intergenic
1038782163 8:30577456-30577478 TGCCATGTTTTGGGGCTTGGAGG + Intergenic
1041339940 8:56834007-56834029 TGAAAGATGGTGCAGCTTGGTGG - Intergenic
1042210500 8:66375980-66376002 TGGTAGGTGTTGGAGCTTTGAGG - Intergenic
1045322529 8:101092580-101092602 AGCCAGGTGCTGCAGCTGTGAGG - Intergenic
1045656821 8:104395471-104395493 TGCCAGGTGTTAGGGATTGGGGG - Intronic
1050606746 9:7309584-7309606 TTGCTGGTTTTGCAGCTTGGGGG + Intergenic
1051580413 9:18667179-18667201 TGCCAAGAATTGCCGCTTGGGGG - Intronic
1052777156 9:32743542-32743564 TTGCTGGTTTTGCAGCTTGGGGG - Intergenic
1055635553 9:78274305-78274327 TGCCAGGTGTTGGGGTTGGGAGG + Intronic
1055675674 9:78657806-78657828 TGCCAGGTGTAGCCGCTTAGGGG - Intergenic
1057523115 9:95775731-95775753 TGCAGGGTGCTGCAGCATGGTGG + Intergenic
1057778322 9:98028606-98028628 GGTCAGGTCTTGCAGCTTGCTGG - Intergenic
1057890508 9:98866643-98866665 TGCCAGGTGCTATAGCTAGGAGG - Intergenic
1060227517 9:121803027-121803049 TGCCCTGTGTTGCAGGTTAGCGG - Intergenic
1062161826 9:135084784-135084806 AGCCAGGAGTGGCTGCTTGGAGG - Intronic
1186180291 X:6967223-6967245 AGCCAGGTCTAGCAGCATGGGGG - Intergenic
1186604120 X:11071117-11071139 TGCCCAGAGTAGCAGCTTGGAGG - Intergenic
1186869144 X:13752756-13752778 TGGCAGGTGTTGGAGTTTGGAGG + Intronic
1187644775 X:21335160-21335182 TTCCTGGTTTTGCGGCTTGGGGG + Intergenic
1189120244 X:38386461-38386483 TGCCAGGGGTTGGAGGTGGGGGG - Intronic
1189473243 X:41330592-41330614 TTCCAGGAGTTACGGCTTGGTGG - Intergenic
1190066774 X:47247083-47247105 TGCCAGCTGGTGCTGCTTGCAGG - Exonic
1193274591 X:79570754-79570776 TGACAGCTGTTGCAGCTTGTGGG - Intergenic
1194473337 X:94325747-94325769 TGAGAGGTGTTGCATCATGGAGG - Intergenic
1194517394 X:94871753-94871775 TGCCAGCTGTTGCAGTGGGGTGG - Intergenic
1194979128 X:100422762-100422784 TGCAAGGGGTTTGAGCTTGGAGG - Intergenic
1197812845 X:130463437-130463459 TGCAATGTGTTGGAGCTGGGAGG - Intergenic
1199604357 X:149564863-149564885 TTGCTGGTTTTGCAGCTTGGGGG + Intergenic
1200720465 Y:6600620-6600642 TGACAGGGGTTGCTGTTTGGGGG + Intergenic
1202372793 Y:24209834-24209856 GGGCAGGTGTTGCAGCTTGTGGG - Intergenic
1202497989 Y:25460286-25460308 GGGCAGGTGTTGCAGCTTGTGGG + Intergenic