ID: 1101999385

View in Genome Browser
Species Human (GRCh38)
Location 12:109547345-109547367
Sequence CTGGTTGCTGAGATCAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1101999381_1101999385 10 Left 1101999381 12:109547312-109547334 CCAAGCTTGCAAAATTGGGATGA No data
Right 1101999385 12:109547345-109547367 CTGGTTGCTGAGATCAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1101999385 Original CRISPR CTGGTTGCTGAGATCAAACA AGG Intergenic
No off target data available for this crispr