ID: 1102002699

View in Genome Browser
Species Human (GRCh38)
Location 12:109567414-109567436
Sequence CCCATGCACCTATAACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102002692_1102002699 30 Left 1102002692 12:109567361-109567383 CCCAGAGACAATCAGCAGCGGTG 0: 1
1: 1
2: 1
3: 5
4: 99
Right 1102002699 12:109567414-109567436 CCCATGCACCTATAACCCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 99
1102002693_1102002699 29 Left 1102002693 12:109567362-109567384 CCAGAGACAATCAGCAGCGGTGC 0: 1
1: 1
2: 1
3: 7
4: 76
Right 1102002699 12:109567414-109567436 CCCATGCACCTATAACCCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102002699 Original CRISPR CCCATGCACCTATAACCCCA GGG Intronic
902784967 1:18727175-18727197 CCCATGCACATATAACACACAGG + Intronic
904675654 1:32197841-32197863 CCCATGGTCCGATAACCTCATGG - Exonic
906297827 1:44659819-44659841 ACCAAGTCCCTATAACCCCATGG + Intronic
910493959 1:87805101-87805123 TCCATACACCAATAACACCAGGG - Intergenic
915655892 1:157360214-157360236 CCTATGCACCTGTTACCTCATGG - Intergenic
915926958 1:160029848-160029870 CCCATGCAGCTATGACTACAGGG + Exonic
919418543 1:197341719-197341741 CCAATGCACCTTTAATCCCATGG + Intronic
1063866312 10:10368748-10368770 TCCAAGCACCTCTCACCCCAAGG + Intergenic
1065814582 10:29472677-29472699 CCCATGGCCTTATAACCCCAGGG - Intronic
1068654709 10:59562874-59562896 CACTTGCAGCTACAACCCCATGG - Intergenic
1072085833 10:92078179-92078201 CCCAAGGTCATATAACCCCAAGG + Intronic
1073811509 10:107157114-107157136 CCCATGCACCTGTATCCTTAAGG - Intronic
1075159015 10:120006314-120006336 CTCATGCACCGCTGACCCCAAGG - Intergenic
1078070278 11:8104082-8104104 TCCATGCACCCATGGCCCCAGGG - Exonic
1084103430 11:66965079-66965101 CCCAGGCTCCTTTAACCCCATGG - Intergenic
1088888088 11:114023226-114023248 CCCAGAAACCTAGAACCCCAAGG + Intergenic
1090771790 11:129927072-129927094 AGCAGGCACCTGTAACCCCAGGG + Intronic
1095962900 12:47846498-47846520 CCCACCCACCTCCAACCCCATGG + Intronic
1096997420 12:55847551-55847573 GCCTTCCACCCATAACCCCATGG - Intergenic
1098666779 12:73173326-73173348 CCCAAGTACCTGTAACTCCAAGG + Intergenic
1101720190 12:107344271-107344293 CCCCAGCACCCATATCCCCAAGG + Intronic
1101750482 12:107579269-107579291 AGCATGCACCTGTCACCCCAGGG - Intronic
1102002388 12:109565539-109565561 CCCACTCACCTATCACCACAGGG - Intronic
1102002699 12:109567414-109567436 CCCATGCACCTATAACCCCAGGG + Intronic
1103340603 12:120219324-120219346 CCCAGGGACCTGAAACCCCAAGG - Intronic
1110150690 13:72249575-72249597 CCCATACACATATAAACCCAAGG - Intergenic
1110753997 13:79149779-79149801 CCAATGCATCTATAACTTCATGG - Intergenic
1132272188 15:100536144-100536166 CCCATGCACATATGAGCACAGGG - Intronic
1136926614 16:34380912-34380934 GCCCTGCAGCTATAACCTCACGG - Intergenic
1136977960 16:35030895-35030917 GCCCTGCAGCTATAACCTCACGG + Intergenic
1143202307 17:5121512-5121534 ACCCTGTACCTATCACCCCAGGG + Exonic
1144876381 17:18399471-18399493 CCCCTGCTCCTATAGCCCCACGG - Intergenic
1145155846 17:20544949-20544971 CCCCTGCTCCTACAGCCCCACGG + Intergenic
1146106824 17:30046354-30046376 CCCACCCACTGATAACCCCAGGG - Intronic
1146843295 17:36169014-36169036 CCCCTGCTCCTACAGCCCCACGG + Intronic
1146855603 17:36256955-36256977 CCCCTGCTCCTACAGCCCCACGG + Intronic
1146865018 17:36331420-36331442 CCCCTGCTCCTACAGCCCCACGG - Intronic
1146871509 17:36380866-36380888 CCCCTGCTCCTACAGCCCCACGG + Intronic
1146878868 17:36431948-36431970 CCCCTGCTCCTACAGCCCCACGG + Intronic
1147067877 17:37932014-37932036 CCCCTGCTCCTACAGCCCCACGG - Intronic
1147074395 17:37981490-37981512 CCCCTGCTCCTACAGCCCCACGG + Intronic
1147079408 17:38011569-38011591 CCCCTGCTCCTACAGCCCCACGG - Intronic
1147085918 17:38061029-38061051 CCCCTGCTCCTACAGCCCCACGG + Intronic
1147095348 17:38135511-38135533 CCCCTGCTCCTACAGCCCCACGG - Intergenic
1149846457 17:60011504-60011526 CCCCTGCTCCTACAGCCCCACGG + Intergenic
1150084805 17:62268079-62268101 CCCCTGCTCCTACAGCCCCACGG + Intergenic
1151917457 17:77128843-77128865 CCCATGCACCCCTAGCCCCTTGG + Intronic
1152544350 17:80993208-80993230 CCCAAGCACCCAAAATCCCAGGG - Intronic
1155240732 18:23861574-23861596 ATCATGCACCCATCACCCCAGGG + Intronic
1155344883 18:24848286-24848308 CCCATGGAGCTATTAACCCATGG - Intergenic
1157955158 18:52088714-52088736 AACATGCACCTATAGCCTCATGG + Intergenic
1161290592 19:3491689-3491711 CCGATGCACCGAGAACCCCATGG - Exonic
1163417595 19:17195816-17195838 CCCCTGCTCCTTTAACCCCGAGG - Intronic
1167150785 19:47708242-47708264 CCCACCCACATACAACCCCAGGG - Intergenic
926626725 2:15096659-15096681 ACCAAGCACCTATGACACCAAGG + Intergenic
927046206 2:19281327-19281349 CCCACCCACCTATACCCTCATGG + Intergenic
928092186 2:28381762-28381784 CCCATGCACCTGGGAGCCCAAGG - Intergenic
931913148 2:66924222-66924244 CCCATGCAAGTATATCACCATGG - Intergenic
935249427 2:101248642-101248664 CCCATTCACATTTAACCCTAGGG + Intronic
941765269 2:169289958-169289980 CCCATGTAACTGCAACCCCAAGG - Intronic
941779850 2:169432186-169432208 CCCATGAACCCATCAACCCAGGG - Intergenic
946052875 2:216878741-216878763 CCCAGGAACCTATGACCTCATGG - Intergenic
947240809 2:227992470-227992492 CCTATGACCCTACAACCCCAGGG - Intronic
948357687 2:237393060-237393082 CCCATGCAGCTAGGACACCATGG + Intronic
1173571668 20:44081099-44081121 GCCCTACACCTACAACCCCACGG + Intergenic
1178277218 21:31249887-31249909 CCAATGCAACTGTAAACCCAAGG + Intronic
1181732661 22:24859039-24859061 CACACGCACCTATAACCCCAAGG - Intronic
1183641459 22:39095431-39095453 CCCAAGCTCCTGTGACCCCAGGG + Intergenic
1185141037 22:49101415-49101437 CCCCTGCAGGTCTAACCCCAGGG + Intergenic
949965625 3:9353697-9353719 TCCATGAACCTTTAACCCGAAGG - Intronic
953127821 3:40108948-40108970 CCCCTGCCCCAATCACCCCAGGG + Intronic
955485542 3:59431195-59431217 CTCATGCACCTGTTACCCCAGGG - Intergenic
955770587 3:62381104-62381126 GTCATTCACCTAGAACCCCAGGG - Intergenic
965508383 3:169541187-169541209 CCCACACACCAATATCCCCAGGG - Intronic
969342827 4:6553085-6553107 CCCCTGCACCTTTCAGCCCAGGG - Intronic
974931265 4:68363956-68363978 CCCATGATCCTATCGCCCCATGG - Intergenic
975165401 4:71173005-71173027 CCCATGCACTGGTAACACCATGG - Intergenic
975706995 4:77121484-77121506 CCCATGCAGTGATGACCCCAAGG + Intergenic
976764850 4:88589351-88589373 CTCATGCCCCTGTAATCCCAGGG - Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
986255603 5:6100467-6100489 CCCATGGACCTCCCACCCCATGG + Intergenic
986255807 5:6101095-6101117 CCCATGGACCTCCCACCCCATGG + Intergenic
986255814 5:6101111-6101133 CCCATGGACCTCCCACCCCATGG + Intergenic
987811498 5:22841932-22841954 CACATTCAGCTATAACCACATGG + Intronic
999125144 5:149240817-149240839 CTCAGGCACCTGTGACCCCATGG - Intronic
999434810 5:151555184-151555206 CACATGCATCAATAGCCCCAAGG + Intronic
1007449264 6:41930793-41930815 AGCCTGCACCTATAAACCCAAGG - Intronic
1013216495 6:108032348-108032370 CCCATGACCCCAAAACCCCAGGG + Intergenic
1014941381 6:127443792-127443814 CACATGCACCTACAAACACATGG + Exonic
1016994297 6:149950758-149950780 CCCATGCACCTTTTACCTCGGGG - Intergenic
1017545753 6:155449469-155449491 TTCAGGGACCTATAACCCCATGG - Intronic
1018321382 6:162612918-162612940 CCCACCAACCTATAACCCCTTGG + Intronic
1018771024 6:166971515-166971537 CCCAGGCACCTGTAACACCACGG - Intergenic
1019622089 7:1997607-1997629 AACATGCACCTGTAACCCCCGGG + Intronic
1026600635 7:71774602-71774624 TCTATGCGCCGATAACCCCATGG - Intergenic
1029582734 7:101448100-101448122 CCGATGCACCCAGAACCCCTGGG + Intronic
1030121827 7:106117634-106117656 CCCATCCACATTTAATCCCAGGG - Intergenic
1034125636 7:148668989-148669011 CACCTGCACCTATAAGCCCTGGG + Intergenic
1037067829 8:14604378-14604400 CCCATTCTCCTATATGCCCATGG - Intronic
1037439027 8:18895161-18895183 CCCCTGCACCTATCATCCCCTGG + Intronic
1039369562 8:36970980-36971002 ACAATGCTCCTATGACCCCAAGG - Intergenic
1041968698 8:63711963-63711985 CCCATGCAGCTCTGCCCCCATGG - Intergenic
1049201989 8:141344896-141344918 CCCCTGCACCTGTGGCCCCACGG + Intergenic
1052981987 9:34456998-34457020 CCCTTGGGCCTATAACCCCCTGG - Intronic
1058462881 9:105198982-105199004 TCCATGCTCCTTTAACTCCATGG - Intergenic
1185538568 X:883832-883854 CCCAGGCACCTGCAACACCATGG - Intergenic
1187125168 X:16447933-16447955 GCGATGTACCTTTAACCCCAAGG - Intergenic
1188818468 X:34743962-34743984 CCAATTCAACTACAACCCCAAGG - Intergenic
1196296690 X:114005765-114005787 CCCTTGGACCTATAATCACATGG - Intergenic