ID: 1102003179

View in Genome Browser
Species Human (GRCh38)
Location 12:109571372-109571394
Sequence CTGTAACCCCAGCAGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 697
Summary {0: 1, 1: 5, 2: 37, 3: 127, 4: 527}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102003179_1102003186 27 Left 1102003179 12:109571372-109571394 CCAAGTAGCTGCTGGGGTTACAG 0: 1
1: 5
2: 37
3: 127
4: 527
Right 1102003186 12:109571422-109571444 TTGTATTTTTAGTAGAGATGGGG 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
1102003179_1102003184 25 Left 1102003179 12:109571372-109571394 CCAAGTAGCTGCTGGGGTTACAG 0: 1
1: 5
2: 37
3: 127
4: 527
Right 1102003184 12:109571420-109571442 TTTTGTATTTTTAGTAGAGATGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1102003179_1102003185 26 Left 1102003179 12:109571372-109571394 CCAAGTAGCTGCTGGGGTTACAG 0: 1
1: 5
2: 37
3: 127
4: 527
Right 1102003185 12:109571421-109571443 TTTGTATTTTTAGTAGAGATGGG 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102003179 Original CRISPR CTGTAACCCCAGCAGCTACT TGG (reversed) Intronic
901008271 1:6182190-6182212 CTGTAGTCCCAGCTGCTACTGGG - Intronic
901384668 1:8899837-8899859 TAGTAATCACAGCAGCTACTCGG - Intergenic
901526836 1:9828568-9828590 CTGTAGTCCCAGCTACTACTCGG + Intergenic
901575290 1:10195887-10195909 CTGTAGTCCCAGCTGCTTCTTGG - Intergenic
902309451 1:15569905-15569927 CTGTAATCCCAGCAGCACTTTGG - Exonic
902720192 1:18298893-18298915 CAGTAACCCCAGGACCTACTTGG + Intronic
903050424 1:20596345-20596367 CTGCAGCCTCAGCAGCTCCTGGG + Intronic
903403536 1:23076837-23076859 CTGTAATCCCAGCAGTTACTTGG + Intronic
903678092 1:25078532-25078554 CTGTAATCCCAACTACTACTTGG + Intergenic
903988313 1:27245825-27245847 CTGTAATCCCAGCACTTTCTGGG - Intronic
904023106 1:27483511-27483533 CTGTAATCCCAGCTGCTACTAGG + Intronic
904034380 1:27551052-27551074 CTGGAGCCCCAGCAGCCCCTGGG - Exonic
904182444 1:28675552-28675574 ATGTCATCCCAGCTGCTACTCGG + Intronic
904384080 1:30130308-30130330 CTGGCACCCCAGCAGCTCCCTGG + Intergenic
904440951 1:30530429-30530451 CTGTAATCCCCCCAGCTACTCGG + Intergenic
904482568 1:30803215-30803237 CTGCAGTCCCAGCTGCTACTTGG + Intergenic
904648865 1:31989158-31989180 CTGTAATCCCAGCAGCACTTTGG - Intergenic
904929847 1:34078093-34078115 CTGTAGTCCCAGCTACTACTCGG - Intronic
904974976 1:34449074-34449096 CTGTAATCCCAGCAGGTTCCTGG - Intergenic
905662299 1:39736938-39736960 CTGTACTCCCAGCTGCTACTCGG + Intronic
905710264 1:40096358-40096380 CTGTATCCTCAGCACCTAGTAGG + Intronic
905831784 1:41075119-41075141 CTGTAATCCCAGCACTTAATGGG - Intronic
905928310 1:41767753-41767775 CTGTGACTCCAGCTGCTGCTGGG - Intronic
906316442 1:44789131-44789153 TTGTAATCCCAGCAGGTACATGG + Intergenic
906366906 1:45218197-45218219 CTGTAATTCCAGCTGCTACTTGG - Intronic
907128538 1:52074321-52074343 CTGTAATCCCGGCTACTACTTGG - Intronic
907380135 1:54080401-54080423 CTGTAATCCCAGCACTTATTAGG - Intronic
908189421 1:61686538-61686560 CTGTAATCCCAGCTACTACTAGG + Intronic
908998975 1:70195756-70195778 CTGTAAGTCCAGCTGCTGCTCGG - Intronic
909010715 1:70331698-70331720 CTGTAATCCCAGCTACTACTAGG + Intronic
909518805 1:76543325-76543347 CTATAACACAAGCTGCTACTGGG + Intronic
909617623 1:77629494-77629516 CTGTAGTCCCAGCAGCAACTTGG + Intronic
911695185 1:100882562-100882584 CTGTAATCCCAGCACTTACGGGG + Intronic
911982566 1:104584866-104584888 CTGTAATCCCAGCTACTACAGGG - Intergenic
912160233 1:106974150-106974172 CTGTAGTCCCAGCTACTACTTGG - Intergenic
914751774 1:150539599-150539621 CTGTAATCCCAGCTACTACGAGG + Intergenic
916021688 1:160798235-160798257 CTGGAAGCCCAGGAGCTGCTGGG - Intronic
917343926 1:174009017-174009039 CTCTAACATTAGCAGCTACTTGG - Intronic
917565034 1:176204800-176204822 CTGTAATCCCAGCTACTACTCGG + Intronic
918547449 1:185700922-185700944 CTATAACCCCACCTTCTACTGGG - Intergenic
918659425 1:187071667-187071689 CTGTAATCCCAGCAGCACCTTGG - Intergenic
919692751 1:200542229-200542251 CTGTAATTCCAGCTACTACTCGG + Intergenic
920591158 1:207220463-207220485 CTGTGACCCCAGGCGCTGCTAGG + Intergenic
922557428 1:226543135-226543157 TTGTTGACCCAGCAGCTACTTGG + Intergenic
922974166 1:229769757-229769779 CTGTCTCCCCAGCTGCTGCTTGG - Intergenic
923618273 1:235555987-235556009 CTGTAACCCCAGCTACTAGAAGG - Intronic
923656990 1:235925606-235925628 CTGTAATCCCAGCAGCACTTTGG + Intergenic
923982784 1:239344159-239344181 CTGTAATCCCAGCTGCTAGGAGG + Intergenic
924240814 1:242038540-242038562 CTGTAATCCCAGCACTTACACGG - Intergenic
1062980614 10:1719084-1719106 CTGTAATCCCAGCTACTACTTGG - Intronic
1063595108 10:7427843-7427865 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1064411380 10:15107572-15107594 CTGTAATCCCAGCTGCTAGGAGG - Intronic
1064438480 10:15332073-15332095 CTGTAATCCCAGCTACTACCTGG - Intronic
1065041238 10:21698995-21699017 CTGTAATCCCAGCTACTACGGGG - Intronic
1065238373 10:23678967-23678989 CTATAGTCCTAGCAGCTACTTGG + Intergenic
1065816623 10:29488351-29488373 CTGGAGTCCCAGCAGCTACTGGG - Intronic
1065956239 10:30696305-30696327 CTGGGGTCCCAGCAGCTACTGGG + Intergenic
1066068436 10:31779423-31779445 CTGTAATCCCAGTTACTACTTGG + Intergenic
1066231466 10:33438850-33438872 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1066538051 10:36412726-36412748 CTGTAGTCCCAGCAGTTACTAGG + Intergenic
1068085442 10:52368230-52368252 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1068571937 10:58639518-58639540 CTGTAATCCCAGCTACTACTTGG - Intronic
1068871755 10:61952685-61952707 CTGTAGAAGCAGCAGCTACTTGG + Intronic
1069019500 10:63470214-63470236 CTATACTCCCAGCAGCTACCAGG + Intergenic
1069025966 10:63542200-63542222 CTGTAATCCCAGCTACTAGTGGG - Intronic
1069476996 10:68743421-68743443 CTGTAATCCCAGCACTTCCTGGG - Intronic
1069778333 10:70939617-70939639 CTGTGCCTCCAGCAGCCACTGGG - Intergenic
1069905527 10:71730092-71730114 CTGTAATCCCAGCAGCACTTTGG - Intronic
1069935995 10:71916559-71916581 CTGTAATCCCAGCCCCTACCTGG + Intergenic
1070242989 10:74701816-74701838 ATGTAGTCCCAGCTGCTACTTGG + Intronic
1070657349 10:78280548-78280570 CTGTGTCCCTAGCAGCAACTGGG - Intergenic
1071685582 10:87751749-87751771 CTGAAACTCCAGCACCAACTGGG - Exonic
1072104729 10:92263196-92263218 CTGTAATCCCAGCTACTCCTGGG - Intronic
1072343445 10:94478583-94478605 CTGTAGTCCCAGCTGCTATTTGG + Intronic
1073192569 10:101662226-101662248 CAGTAAACCCTGTAGCTACTGGG + Intronic
1073261780 10:102196058-102196080 CTGTAATCCCAGCTACTAGTGGG - Intergenic
1073666688 10:105541851-105541873 CTGTATCCTCAGCATCTAATAGG + Intergenic
1074202970 10:111256236-111256258 CTGTAATCCCAGCTACTACTCGG + Intergenic
1075509622 10:123060734-123060756 CTGTAATCCCGCTAGCTACTCGG + Intergenic
1076805007 10:132851098-132851120 CTGTGACCCCAGCAATTACCAGG + Exonic
1077422289 11:2458432-2458454 ACGCAACCCCATCAGCTACTGGG - Intronic
1077629230 11:3799413-3799435 CTATAATCCCAGCTGCTTCTCGG + Intronic
1078189384 11:9078988-9079010 CTGTAACCCCAGCACACATTTGG + Intronic
1079797645 11:24826048-24826070 CTGTAGTCCCAGCTACTACTCGG + Intronic
1080631746 11:34083808-34083830 CTGTAACCCCAGCACTTTGTGGG + Intronic
1081930057 11:46863198-46863220 CTGTAACCCCAGCTGATATCTGG + Intronic
1083039490 11:59671786-59671808 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
1083371945 11:62189421-62189443 CAGACACCCCAGCAGCTCCTTGG + Intergenic
1083612213 11:64009719-64009741 CTTTAGCCCCAGCAGCCCCTGGG + Intronic
1083857904 11:65402226-65402248 CCGTAATCCCAGCTACTACTTGG + Intronic
1083864744 11:65447521-65447543 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1084256176 11:67944353-67944375 CTATAAACACAGCAGGTACTAGG + Intergenic
1084343670 11:68527846-68527868 CTGTGACTCCTGAAGCTACTGGG + Intronic
1084633500 11:70373351-70373373 CTGTACTCCCAGGAGCTACTAGG - Intronic
1084816585 11:71650946-71650968 CTATAAACACAGCAGGTACTAGG - Intergenic
1084843141 11:71874985-71875007 CTGCAACTCCAGCAGCCACTTGG + Intronic
1084894647 11:72257059-72257081 CTGTAATCCCAGCTACTACCTGG - Intergenic
1085065836 11:73494875-73494897 CTGTAATCCCAGCTACTACTTGG + Intronic
1085139232 11:74125288-74125310 CTGTAATCCTAGCTACTACTAGG - Intronic
1086114935 11:83238881-83238903 CTGTAGTCCCAGCTACTACTTGG + Intronic
1086782184 11:90921101-90921123 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1087020044 11:93592901-93592923 CTGTAATCCCAGCTACTACTTGG + Intergenic
1087634090 11:100683892-100683914 CTGTAATCCCAGCAGGTACTAGG - Intergenic
1087666531 11:101055288-101055310 CTGTAGTCTCATCAGCTACTTGG + Intronic
1088099165 11:106135366-106135388 CTGGAACTCCAGCAGCTATTTGG - Intergenic
1088249814 11:107852747-107852769 CTGTAATCCCAGCTACTACTAGG + Intronic
1088446902 11:109940530-109940552 CTGTAATCTCAGCTGCTACTTGG + Intergenic
1089163214 11:116455442-116455464 CACTAAGCCCAGCAGCTCCTGGG - Intergenic
1089205671 11:116760507-116760529 CTATAAACGCAGAAGCTACTTGG + Intronic
1089387194 11:118076144-118076166 CTGTAATCCCAGCAGCTACTTGG + Intergenic
1089999544 11:122943130-122943152 CTGTAATCCCAGCAGCTCAAGGG - Intronic
1090700822 11:129294079-129294101 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1092197222 12:6556596-6556618 CTGTAATCCCAGCACTTTCTGGG - Intergenic
1092372521 12:7928911-7928933 CTGTAGTCCCAGCTACTACTCGG - Intronic
1092426409 12:8379085-8379107 CTATAAACACAGCAGGTACTGGG + Intergenic
1093015936 12:14154750-14154772 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1093077879 12:14775470-14775492 ATGAAAGCACAGCAGCTACTAGG - Intronic
1093455394 12:19360205-19360227 CTGTAGTCCCAACTGCTACTGGG + Intronic
1095735827 12:45555285-45555307 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1096269107 12:50149863-50149885 CTGTAGTCCCAGCTACTACTTGG - Intronic
1096300560 12:50423875-50423897 CTGTAATCCCAGCTACTACTCGG - Intronic
1096394918 12:51258465-51258487 CTATAATCCCAGCTACTACTGGG + Intronic
1096432346 12:51557083-51557105 CTGTAATCCCAGCTGCTTGTGGG + Intergenic
1096644918 12:53027390-53027412 CTGTAATCCCAGCAGCACTTTGG - Intronic
1097159319 12:57035128-57035150 GTCTAAACCCAGCAGCTTCTGGG + Intronic
1097224485 12:57469331-57469353 TTGGAACCCCAGCAGTCACTGGG + Intronic
1097782701 12:63726483-63726505 CTGTAATCCCAGCTACTACTCGG + Intergenic
1098898534 12:76089201-76089223 CTGTAATCCCAGCTACTACTTGG - Intergenic
1098970424 12:76849184-76849206 CTGTAATCCCAGCTGCTGGTGGG + Intronic
1100055345 12:90502711-90502733 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1100278635 12:93096214-93096236 CTGTAATCCCAGCTACTAGTGGG - Intergenic
1101012649 12:100467047-100467069 CTGTAGTCGCAGCTGCTACTTGG + Intergenic
1101096168 12:101343633-101343655 CTGTAATCCCAGCTACTATTCGG - Intronic
1101380350 12:104208821-104208843 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1101464260 12:104931455-104931477 CTGTAGCCCCAGCATCTTGTAGG - Intronic
1101690586 12:107076486-107076508 CTGTAATTCCACTAGCTACTCGG + Intronic
1101715710 12:107310083-107310105 CTATATCCCCAGCATTTACTAGG - Intergenic
1101819604 12:108173604-108173626 CCCTTACCCCAGCATCTACTGGG - Intronic
1102003179 12:109571372-109571394 CTGTAACCCCAGCAGCTACTTGG - Intronic
1102305161 12:111799286-111799308 CTGTAATCCCAGCTACTAGTAGG - Intronic
1102311299 12:111846619-111846641 CTGTAATCCCAGCTACTACTCGG - Intronic
1102417174 12:112773957-112773979 CTGTAATCCCAGCTACTACTTGG + Intronic
1102684842 12:114716766-114716788 CTGTAATCCCAGCTCCTCCTGGG - Intergenic
1103230985 12:119330259-119330281 CTGTGACACCAGCTGCTTCTGGG - Intergenic
1103315834 12:120054333-120054355 CTGTAATCCCAGCACCAATTTGG - Intronic
1103473703 12:121202457-121202479 CTGTAATCCCAGCTACTACTTGG + Intergenic
1103500211 12:121395878-121395900 CTGTAACCCCAGCTACTACTCGG + Intronic
1103850048 12:123927167-123927189 CTGTAGTCTCAGCTGCTACTGGG - Exonic
1105047496 12:133017343-133017365 CTGTCACACCAGCCGCTTCTAGG - Exonic
1105312936 13:19229571-19229593 CTGTAACCCTCCTAGCTACTTGG - Intergenic
1105386731 13:19937251-19937273 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1105728249 13:23186708-23186730 CTGTCAGGCCAGCAGCTGCTGGG + Intronic
1105895245 13:24711831-24711853 GTGTAACCCAGGCATCTACTGGG + Intronic
1105926834 13:25016611-25016633 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1106470341 13:30048806-30048828 CTATAATCCCAGCTACTACTTGG + Intergenic
1106731058 13:32541834-32541856 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1106739165 13:32620529-32620551 CTGTAGTCCCAGCAGCTACTTGG + Intronic
1108580682 13:51825864-51825886 CTGTAATCCCAGCAGTTAGTGGG - Intergenic
1108677700 13:52751484-52751506 CTGTAATCCCAGCACTTTCTGGG + Intergenic
1110317288 13:74124896-74124918 CTGTAACCCCAGCAGCAAGGCGG + Intronic
1110488274 13:76071705-76071727 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1110884627 13:80617812-80617834 CTATAGTCCCAGCTGCTACTTGG + Intergenic
1111421001 13:88011071-88011093 CTGTAGTCCCAGCAGCTACCTGG - Intergenic
1112001266 13:95211920-95211942 CTGTAATCCCAGCACTTAGTGGG + Intronic
1112427160 13:99313105-99313127 CTGTAGTCCCAGCTACTACTCGG - Intronic
1113201162 13:107868069-107868091 CTGTCACCCAGGCAGCTACACGG - Intergenic
1113338323 13:109397977-109397999 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1113937748 13:114003359-114003381 CTGTATCTACAGCAGCTTCTCGG + Intronic
1114753482 14:25231720-25231742 CTGTGATCCCAGCTACTACTCGG - Intergenic
1115232495 14:31176673-31176695 CTGTAATCCCAGCAGCACTTTGG + Intronic
1115492239 14:33968624-33968646 CTGTAATCCCAGCAGTTTCTGGG - Intronic
1115693508 14:35872086-35872108 CTGTAACCTCAGCACTTTCTGGG + Intronic
1115987082 14:39112991-39113013 CTGTAGTCCCGGCGGCTACTCGG + Intergenic
1116159384 14:41249488-41249510 CTGTAATCCCAGCTGCTACTTGG + Intergenic
1116359362 14:43973691-43973713 CTGTAATCCCAGCTACTAGTAGG + Intergenic
1117590713 14:57265463-57265485 CTGTAATCCCAGCACCTTGTGGG + Intronic
1118193769 14:63605580-63605602 CTGTAATCCCAGCTGCTTCGGGG - Intronic
1118203764 14:63702447-63702469 CTGTAATCCCAGCAGCACTTTGG + Intronic
1118413906 14:65512286-65512308 CTGTAATCCCAGCTACTACCTGG - Intronic
1118758470 14:68862916-68862938 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1118803536 14:69213324-69213346 CTGTAACCCCAGCACATTTTGGG - Intronic
1119189261 14:72669298-72669320 CTGTTAACCAGGCAGCTACTTGG + Intronic
1119205333 14:72789791-72789813 CTGTAATCCCAGCAGCACTTTGG - Intronic
1119206895 14:72801145-72801167 CTCAATCCCCAGCATCTACTTGG + Intronic
1119237216 14:73029709-73029731 CTGTAATCCCAGCAACTAGAGGG + Intergenic
1119457543 14:74769407-74769429 CTGTAATCCCAGCTACTCCTGGG - Intronic
1119517696 14:75261308-75261330 CTGTAATCCCAGCAGCACTTTGG - Intronic
1119555381 14:75548525-75548547 CTGTGACCCCACCACCTGCTGGG - Intergenic
1120216911 14:81690213-81690235 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1121252666 14:92511526-92511548 CTTCAACCCCAGCGGCTTCTGGG - Intergenic
1121341100 14:93105645-93105667 CTGTAATCCCAGCTACTACTCGG - Intronic
1121397330 14:93637578-93637600 CTGTAATCCCAGCTACTCCTCGG - Intronic
1121742853 14:96266262-96266284 CTGTAACCCCACCTGCCTCTGGG - Intronic
1121907250 14:97757714-97757736 CTGTAACCACAGCTGCTTCCCGG + Intronic
1122260533 14:100517719-100517741 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1122490852 14:102115019-102115041 CTGTAGTCCCACCTGCTACTCGG + Intronic
1123705314 15:22947139-22947161 CTGTACGCCCTGCAGCTGCTGGG + Intronic
1123928896 15:25148033-25148055 CTGTAATCCCAGCTACTAGTGGG - Intergenic
1124147636 15:27142875-27142897 CTGTAGTCCCCCCAGCTACTGGG - Intronic
1125627781 15:41122866-41122888 CTGTAATCCCAGCAGCTACTTGG - Intergenic
1126592771 15:50355899-50355921 CAGTAATCCAAGCAGTTACTAGG - Intergenic
1127023349 15:54775709-54775731 CTGCAACCCCAGCTGCTGCTGGG - Intergenic
1127126024 15:55812797-55812819 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1127314628 15:57783147-57783169 CTGCACCCCCAGCTTCTACTTGG - Intergenic
1127551547 15:60043608-60043630 CAGGAATCCCAGCAGCTCCTTGG - Intronic
1127626812 15:60787920-60787942 CAGTATCCCCAGCAGCCACAAGG - Intronic
1128044216 15:64603392-64603414 CTGTAATCCCAGCTACTTCTGGG - Intronic
1128139915 15:65292044-65292066 CTGTAACCCCAGCAGCACTTTGG - Intronic
1128281256 15:66396525-66396547 CTGTAATCCCAGCACCTTGTGGG - Intronic
1128373352 15:67057443-67057465 CTGTAATCCCAGCTACTACTCGG - Intergenic
1128889982 15:71322838-71322860 CTGTAATCCCAGCACCTAAAAGG + Intronic
1129556791 15:76518394-76518416 CTTTTACCCCAGCTGCTTCTTGG - Intronic
1129647749 15:77453103-77453125 CTGTAATCCCAGCTACTACTTGG + Intronic
1131181972 15:90246526-90246548 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1131203540 15:90421781-90421803 CTGCAATCCCAGCCACTACTTGG - Intronic
1131877868 15:96829923-96829945 CAGTAAGCACATCAGCTACTTGG + Intergenic
1132494709 16:256694-256716 CTGTAATCCCAGCTACTACTTGG - Intronic
1132877196 16:2145234-2145256 CTGTAATCCCAGCAGCACTTTGG - Intronic
1133208526 16:4249113-4249135 CTGTAATCCCAGCTACTAGTGGG - Intergenic
1133371889 16:5251481-5251503 CTATAAACACAGCAGGTACTAGG - Intergenic
1133402905 16:5501836-5501858 CTGTAGTCCCAGCATGTACTGGG - Intergenic
1133537807 16:6718986-6719008 CTGTAGTCCCAGAAGCTACTTGG - Intronic
1133763073 16:8815351-8815373 CTGTAATCCCAGCCACTAATCGG - Intronic
1134027094 16:10962799-10962821 CTGTAACCCCAGCACTTAGGAGG + Intronic
1134090829 16:11390872-11390894 CTGTCACCAGAGCAGCTCCTGGG - Intronic
1134281265 16:12819118-12819140 CTGTAATCCCAGCTGCTGCTAGG + Intergenic
1134651007 16:15908701-15908723 CTGTAATCCCAGCAACTAGAGGG + Intergenic
1135015035 16:18918135-18918157 CTGTAATCCCTAGAGCTACTTGG + Intronic
1135058099 16:19247487-19247509 CTGTAATCCCAGCAGCACCTTGG - Intronic
1135161395 16:20099865-20099887 CTGTAATCCCAGCACTTATTGGG + Intergenic
1135462002 16:22652582-22652604 CTGTAATCCCAGCAACTTTTTGG + Intergenic
1135639176 16:24105313-24105335 CTGTAACCCCAGCACCACTTTGG - Intronic
1135766980 16:25186234-25186256 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1135774195 16:25241990-25242012 CTGTAATCCCAGCAACTTCTGGG - Intronic
1136041274 16:27580964-27580986 TTGTTATCCCACCAGCTACTTGG + Intronic
1136332132 16:29587107-29587129 CTGTAATCCCTAGAGCTACTTGG + Intergenic
1136371436 16:29839060-29839082 CTGTAATCCCAGCTACTGCTCGG + Intronic
1136446828 16:30327173-30327195 CTGTAATCCCTAGAGCTACTTGG + Intergenic
1136571453 16:31099811-31099833 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1137665670 16:50247485-50247507 CTGTAATCCCAGCTGCTACTCGG - Intronic
1137840471 16:51636430-51636452 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1137976731 16:53038471-53038493 CTGTAATTCCAGCTACTACTCGG - Intergenic
1138668251 16:58591494-58591516 CTGTAATCCCAGCAGTTTGTGGG + Intronic
1138688650 16:58748410-58748432 CTGTAGTCCCACCAGCTACTTGG - Intergenic
1139434879 16:66930739-66930761 CTGTAATCCCAGCAGGTTGTGGG + Intergenic
1139459698 16:67111744-67111766 CTGTAATCCCAGCTACTAGTAGG - Intronic
1139482869 16:67240401-67240423 CTGTAATCCCAGCTACTGCTGGG + Intronic
1140090722 16:71836310-71836332 CTGTAATCCCAGCACTTTCTTGG - Intergenic
1140239428 16:73187982-73188004 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1140906047 16:79410055-79410077 CTGTAACCACAGCAGAGTCTTGG + Intergenic
1141417968 16:83891463-83891485 CTGTAATCCCAGCAGCTACTTGG + Intergenic
1142180475 16:88666861-88666883 CTGTAAGCCCAGCAGCACTTTGG + Intergenic
1142215882 16:88829603-88829625 CTGTGTCCCCAGCAGCCAGTGGG - Intronic
1142581156 17:943697-943719 CTGTAATCCCAGCTACGACTCGG + Intronic
1142607237 17:1088709-1088731 CTGTGATCCCAGCTACTACTCGG - Intronic
1143086770 17:4421885-4421907 CTGTAATCCCAGCTACTTCTGGG + Intergenic
1143280277 17:5748846-5748868 CTGTAATCTCAGCTACTACTAGG - Intergenic
1143531671 17:7508685-7508707 CTGTAATCCCAGCTGCTAGTTGG + Intronic
1144073228 17:11693374-11693396 CTGTAATCTCAGCTACTACTCGG - Intronic
1144657571 17:17047053-17047075 CTGTAATCCCAGCTACTCCTTGG + Intronic
1144804457 17:17955274-17955296 CTCAAACCACAGCAGCTAGTGGG + Intronic
1145104928 17:20107032-20107054 CTGTAGCCCCAACTACTACTTGG + Intronic
1145742302 17:27285547-27285569 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1146070117 17:29672827-29672849 CTGTAATCCCAGCTACTACTCGG - Intronic
1146218217 17:30995877-30995899 CTGTAATCCCAGCTACTACTAGG - Intronic
1146376852 17:32300426-32300448 CTGTAGTCCCACCAGCTACTTGG + Intronic
1147028182 17:37607832-37607854 CTGTAATCCCAGCTGCTCCGAGG + Intronic
1147504519 17:41002315-41002337 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1147833055 17:43310622-43310644 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1147889843 17:43709636-43709658 CTGTAATCCCAGCTACTACTCGG - Intergenic
1147967622 17:44201643-44201665 CTGTAATCCCAGGAGCTACTCGG + Intergenic
1148007315 17:44443929-44443951 CTGTAATCCCAGCACCTTGTGGG - Intronic
1148075788 17:44934585-44934607 CAGTATCTCCAGCAGCTGCTCGG + Exonic
1148617117 17:49009287-49009309 CTGTAATCCCAGCACCTTGTTGG - Intronic
1148817930 17:50344148-50344170 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1148930705 17:51125049-51125071 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1149679812 17:58498103-58498125 CTGTAAACCCAGCTCCTACTTGG + Intronic
1149960597 17:61105545-61105567 CTGTAACCCCAGCTACTCATGGG - Intronic
1150178936 17:63093872-63093894 CTGTAGTCCCAGCTACTACTTGG - Intronic
1150787874 17:68177280-68177302 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1151046261 17:70923064-70923086 CTGTAACCTCAGCTACTCCTGGG + Intergenic
1152796877 17:82312329-82312351 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1152820111 17:82433506-82433528 CTGTAATCCCAGCACCTTGTGGG - Intronic
1153788853 18:8559286-8559308 CTGTAATTCCAGCTACTACTCGG - Intergenic
1153840882 18:9006692-9006714 CTGTAATCCCAGCTGCTACTGGG - Intergenic
1154195643 18:12264467-12264489 CTGTCACCCAAACAGCTACTGGG + Intronic
1154201504 18:12303691-12303713 CTGTCACCCAAACAGCTACTGGG - Intergenic
1154265866 18:12878407-12878429 CTGTAATCCCAGCAGCACTTTGG + Intronic
1154319071 18:13330217-13330239 CTGTAATCCCAGCAGCACTTTGG - Intronic
1155518691 18:26647963-26647985 CTGTAATCCCAGCCACTACTTGG - Intronic
1156274154 18:35566066-35566088 CTGTAACCCCAGCTACAACCTGG + Intergenic
1156552431 18:38031702-38031724 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1158459665 18:57634975-57634997 CTGTAACCCCAGCACTTTGTGGG - Intergenic
1159050775 18:63419289-63419311 CTGTAATCCCAGCTGCTACATGG + Intronic
1159101853 18:63967254-63967276 CTGTAACCCCAGCTACTAGGGGG - Intronic
1160492000 18:79345914-79345936 CTGTACACTCAGCACCTACTTGG + Intronic
1160830248 19:1101199-1101221 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1160977618 19:1801406-1801428 CTGTAATCCCAGCACGTTCTGGG - Intronic
1161532383 19:4797810-4797832 ATGTAGTCCCAGCTGCTACTGGG + Exonic
1161537234 19:4827496-4827518 CTGTAATCCCAGCAGCACTTTGG + Intronic
1161872925 19:6884527-6884549 CTGTAATCCCAGAAACTACTCGG + Intergenic
1161903816 19:7139948-7139970 CTATAATCCCAGCTGCTCCTCGG - Intronic
1162126130 19:8500340-8500362 CTGTCACCCCAGGAGGTAGTGGG + Intronic
1162338896 19:10079533-10079555 CTGTAATCCCAGCTACTACTTGG + Intergenic
1162519089 19:11168532-11168554 CTGTAATCCCAGCACCTTGTGGG - Intronic
1163015997 19:14455037-14455059 CTGTAATCCCACCAGCTATTTGG - Intronic
1163448771 19:17363287-17363309 CTGTTATCCCAGCTGCTTCTTGG - Intronic
1163529790 19:17842603-17842625 CTCCAACCCCTGCAGCTACAAGG - Exonic
1164283698 19:23791255-23791277 CTGTAATCCCAGCACTTACGGGG - Intronic
1164666735 19:30044120-30044142 CTGTAATCCCAGCTACTACTCGG - Intergenic
1164976109 19:32573959-32573981 CTGTAATCCCAGCAGGGATTTGG + Intergenic
1165040100 19:33062987-33063009 CTGGAACTCCAGCAGCACCTGGG - Intronic
1165229046 19:34374985-34375007 CTATAATCCCAGCACTTACTGGG - Intronic
1165567565 19:36744368-36744390 CTGTAATCCCAGCACCTAGGAGG + Exonic
1165746054 19:38229869-38229891 CTGTATCCCCAGCAGCCAATGGG - Intergenic
1165747755 19:38240429-38240451 CTGTAATCCCAGCTACTACTTGG + Intergenic
1165818325 19:38657398-38657420 CTGTAACCCCAGCACTTTGTTGG - Intronic
1165834640 19:38746677-38746699 CTGTAATCCCAGCAGCACTTTGG + Intronic
1166114510 19:40645279-40645301 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1166408712 19:42542135-42542157 CTGTAGTCCCAGCTACTACTCGG - Intronic
1166801281 19:45458922-45458944 CTGTAGTCCCAGCTACTACTTGG + Intronic
1167021892 19:46883215-46883237 CTGTAATCCCAGCTACTAGTGGG - Intergenic
1167199897 19:48057610-48057632 CTGTAATCCCAGCTGCTAGTGGG - Intronic
1167207292 19:48111233-48111255 CTGTAATCCCAGCTACTACTCGG + Intergenic
1167207776 19:48114035-48114057 CTGTAATCCCAGCTACTAGTGGG - Intergenic
1167520742 19:49953133-49953155 CTGTGACCCCAGGTGCCACTGGG + Intronic
1167736867 19:51300043-51300065 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1167872375 19:52382149-52382171 CTATAATCCCAGCTACTACTTGG + Intronic
1168396042 19:56049566-56049588 CTGTAATCCCAGCAGCACTTTGG - Intronic
1168496550 19:56856285-56856307 CTGTAATCCCAGCTACTACTCGG + Intergenic
1168668389 19:58221762-58221784 CTGTAATCCCAGCTACTAGTGGG - Intergenic
925344463 2:3160882-3160904 CTGTAACACGAGCAGCTAGTGGG - Intergenic
925442700 2:3902096-3902118 CTGTATTCCCAGCATCTATTTGG + Intergenic
926902915 2:17775876-17775898 CTGTAATCCCAGCAGCATTTTGG + Intronic
927150688 2:20194004-20194026 CTGTAATCCCAGCTACTACTCGG + Intergenic
927431390 2:23029268-23029290 CTGTAATCCCAGCAGCACTTTGG - Intergenic
927902218 2:26828730-26828752 CTGTAATCCCAGCTAGTACTCGG + Intergenic
928956626 2:36876007-36876029 CTGTAATCCCAGCATTTAGTGGG + Intronic
929564117 2:42974241-42974263 CTGTAACCCCAGCACCTGACAGG - Intergenic
929622399 2:43368656-43368678 CTTTAACCCCAGCAGCACTTTGG - Intronic
929734129 2:44527216-44527238 CTGTAGTCCCAGCTACTACTAGG - Intronic
929745978 2:44659162-44659184 CTGTAACCCCAACAGTTTCAAGG + Intronic
929991153 2:46788062-46788084 CTGTAGTCCCAGTTGCTACTTGG + Intergenic
931403471 2:61953268-61953290 CTGTAATCCCAGCAGCACGTTGG - Intronic
931952344 2:67379439-67379461 CTGTTATCCCAGCAGCTACTTGG - Intergenic
932230051 2:70075721-70075743 CCGTAATCCCAGCTACTACTTGG + Intergenic
932262340 2:70337270-70337292 CTGTAACCCCAGCTACTAGGGGG - Intergenic
934712253 2:96523746-96523768 CTGGATCCCCAGCAACTACAGGG - Intergenic
935402221 2:102671981-102672003 CTGTAATCCCAGCTGCTACTTGG + Intronic
938021969 2:127913268-127913290 CTGTAATCCCAGCTACTAGTGGG - Intergenic
938183977 2:129211682-129211704 CTCTAATCCAAGCAGCTACTCGG - Intergenic
938494750 2:131788889-131788911 CTGTAACCCCAGCACCATTTGGG - Intergenic
939590458 2:144057934-144057956 CTGTAGTCCCAGCAGCTACTTGG - Intronic
939911709 2:147991304-147991326 CTGTAATCCCAGCAGCACTTTGG - Intronic
941043515 2:160648643-160648665 CTGGGTCCCCAGCAGCAACTTGG - Intergenic
941457487 2:165726777-165726799 CTGTAATCCCAGCACCTTGTGGG + Intergenic
942030317 2:171953085-171953107 CTGTAACCCCAGCAGTTTGGGGG + Intronic
942580849 2:177414326-177414348 CTGTAATCCCAGCTACTACAAGG - Intronic
943332123 2:186572286-186572308 CTGTAGTCCCAGCTGCTACTTGG + Intergenic
943608417 2:190003739-190003761 CTGTAATCCCAGCTACTGCTCGG + Intronic
943663753 2:190587321-190587343 CTGTAACCCAAGCTGCTGCAAGG + Intergenic
944035182 2:195286636-195286658 CTGTAGTCCCAGCAGCTATCTGG - Intergenic
945068447 2:205967102-205967124 CTGTAGTCCCAGCAGCTACTTGG - Intergenic
946137795 2:217662378-217662400 CTGTAATCCCAGCTACTACTTGG + Intronic
946147296 2:217740734-217740756 CTGAAACCCCAGCAGCCAAGGGG + Intronic
946198657 2:218056766-218056788 TTGAAATCACAGCAGCTACTTGG - Intronic
946335407 2:219032263-219032285 CTTTACCCCCAGCATCTCCTGGG + Intronic
946387061 2:219389705-219389727 CTGTAATCCCAGCAGCTACTTGG + Intronic
946497091 2:220205696-220205718 CTGTAGTCCCAGCTACTACTCGG - Intergenic
946631156 2:221670852-221670874 CTGTAATCCCAGATACTACTTGG - Intergenic
946952040 2:224886894-224886916 CTGTAATCCCAGGTACTACTTGG - Intronic
947414267 2:229877405-229877427 CTGTAATCCCAGCTACTACTTGG + Intronic
947566219 2:231195369-231195391 TTGTGGTCCCAGCAGCTACTTGG + Intergenic
947767430 2:232646702-232646724 CTGTAATCCCAGCACTTTCTGGG - Intronic
948109320 2:235441776-235441798 CTGCAATCCCACCAGCTACATGG + Intergenic
948718411 2:239881072-239881094 CTGCAACCCCAGAACCTGCTTGG + Intergenic
948999075 2:241602025-241602047 CTGCAAGCCGAGCAGCTGCTGGG - Intronic
949025339 2:241765152-241765174 CTGTATCCCCAGCACCTGGTCGG - Intronic
1169123843 20:3113162-3113184 CTGTAATCCCAGCTACTAGTGGG + Intronic
1169237348 20:3941815-3941837 CTGTAATCCCAGCACCTAAGAGG + Intronic
1169246435 20:4028640-4028662 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1169374331 20:5054373-5054395 CTGTAGTCCCACCAGCTATTTGG + Intergenic
1170636737 20:18112816-18112838 CTGTAATCCCTTAAGCTACTTGG - Intergenic
1170646378 20:18199533-18199555 CTGTAATCCCAGCTCCTCCTTGG + Intergenic
1170873028 20:20225482-20225504 CTGTAACACCAACAGCTGCCGGG - Intronic
1171383373 20:24750594-24750616 GTGTAACATCAGCAGCCACTGGG - Intergenic
1172147825 20:32769208-32769230 CTGTAGTCCCAGCTACTACTAGG - Intronic
1172148131 20:32771556-32771578 CTGTAACCCCTCCACCTCCTGGG - Intronic
1172323191 20:34013286-34013308 CTGTAGTCTCAGCAGCTACTTGG + Intronic
1173168350 20:40701886-40701908 CAGTAACCCCTCCAGCCACTGGG + Intergenic
1173962893 20:47088830-47088852 CTGTAATCCCAGCACCTCCAAGG - Intronic
1174376574 20:50130044-50130066 CTGTTACCCCAGCAGGTGCAGGG - Intronic
1174751540 20:53115969-53115991 CTGTAACCACAGCAGCCCATTGG - Intronic
1174832164 20:53823125-53823147 CTGTAGTCCCAGCAGCTACTTGG + Intergenic
1175103510 20:56596981-56597003 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1175116726 20:56688025-56688047 CTGTAACCCCAGCTACTAGGAGG + Intergenic
1177474585 21:21603092-21603114 CTGTAATCCCAGCTACTACTCGG + Intergenic
1179321302 21:40293697-40293719 CTGTAATCCCAGCTACTACTTGG + Intronic
1180632322 22:17238205-17238227 CTGTAGTCCCAGCTACTACTGGG + Intergenic
1180639856 22:17289520-17289542 CTGTAACCCCAGCATGTACAAGG - Intergenic
1180659890 22:17457565-17457587 CTGTATCCCCAACAGCTAGACGG + Intronic
1181392973 22:22597173-22597195 CTGTAATCCCAGCAGTTAGGAGG + Intergenic
1181979415 22:26755468-26755490 CTATAGCCCCAGCATCTAGTAGG - Intergenic
1182137094 22:27916552-27916574 CTGTAATCCCAGCACTTAGTGGG + Intronic
1182315919 22:29447153-29447175 CTGTAATCCCAGCACTTTCTGGG - Intergenic
1182498154 22:30725383-30725405 CTGTAATCCCAGCTACTACTCGG + Intronic
1183137793 22:35906561-35906583 CTGTAATCCCAGCACTTTCTGGG + Intronic
1183205221 22:36414204-36414226 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1183372959 22:37445532-37445554 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1183494744 22:38136464-38136486 CTGTAATCCCAGCTACTACTCGG + Intronic
1183993006 22:41611253-41611275 CTGTAATCCCAGCCTGTACTTGG - Intronic
1184001708 22:41679294-41679316 CTGTAATCCCAGCAGCACTTTGG + Intronic
1184210831 22:43034751-43034773 CTGTAATCCCAGCTACTTCTTGG + Intergenic
1184469015 22:44684982-44685004 CAGTAACCCCAGCGGCCACCAGG - Intronic
1184488964 22:44798368-44798390 CTGTAATCCCAGCAGCATTTTGG - Intronic
1184635528 22:45825820-45825842 CAGTAATCCCAGCACCTACCAGG + Intronic
950395608 3:12731675-12731697 CTGTAATCCCAGCAGCACTTTGG - Intergenic
950435597 3:12977588-12977610 CTGTCTCCCCAACAGCTACCAGG - Intronic
951382997 3:22008477-22008499 CTGTAGTCCCAGCTACTACTCGG - Intronic
951981564 3:28572821-28572843 CTGTAATCCCAGCTGCTTCGGGG - Intergenic
952901654 3:38115301-38115323 CTGTATCCCCAGCAGCTCTCAGG - Intronic
954565209 3:51594194-51594216 CTGTAATTCCAGCTACTACTCGG - Intronic
955011882 3:55025507-55025529 CTGTGATCCCAGCTGCTACTCGG + Intronic
955287032 3:57651949-57651971 CTGTAACCCCAACACCTAGGTGG + Intronic
955341157 3:58126252-58126274 CTGTAATCCCAGCTACTACTTGG + Intronic
956032183 3:65050491-65050513 CTGGAACTCCAGCAGCTACTTGG + Intergenic
956415962 3:69029564-69029586 CTGTAATCCCAGCAGCTCGGAGG - Intronic
956976038 3:74580977-74580999 CTGTAATCCCAGCAGCACTTTGG - Intergenic
957071093 3:75568390-75568412 CTATAAACACAGCAGGTACTAGG + Intergenic
958717498 3:97803185-97803207 CTGTAATCCCAGCAGGTAATCGG + Intergenic
959699536 3:109285740-109285762 CTGTAGTCCCAGCTGCTCCTAGG - Intergenic
959701620 3:109304145-109304167 CTGTAATCCCAGCTGAGACTCGG + Intronic
960244143 3:115381061-115381083 CTGTATCCCCAGCTGCCAGTAGG + Intergenic
961135749 3:124509329-124509351 CTGTAATCCCAGCAGCTCTGGGG - Intronic
961381832 3:126500436-126500458 CTCACACCCCAGCATCTACTTGG + Intronic
961534134 3:127559123-127559145 CTGTAATCCCAGCTACTACTTGG + Intergenic
962213235 3:133496981-133497003 CTGTAACCCCAGCACTTTGTGGG - Intergenic
962298296 3:134213927-134213949 CTGTAGTCCCACCAGCTACTCGG - Intronic
962993813 3:140605279-140605301 CTCTTTCCCCAGGAGCTACTTGG - Intergenic
963426914 3:145141506-145141528 CTGTGGTTCCAGCAGCTACTTGG - Intergenic
963935454 3:151047518-151047540 CTGTAATCCCCGCTGCTACTCGG + Intergenic
964671461 3:159230501-159230523 CAGAAAACCCAGCATCTACTGGG + Intronic
964718847 3:159751803-159751825 CTGTAATCCCAGCACTTCCTGGG - Intronic
964886485 3:161489365-161489387 CTGTAGTCCCAGCTACTACTTGG - Intergenic
964935617 3:162082543-162082565 CTGTAATCCCAGCTACTACCCGG - Intergenic
965165170 3:165188289-165188311 CTGAAACCCCACCAACTGCTGGG + Exonic
965923913 3:173953798-173953820 CTGTAACCCCAGCACCTGGGAGG - Intronic
966518180 3:180843432-180843454 CTGTAATCCCAGCAGCACTTTGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
966764904 3:183452175-183452197 CTGTACTCCCAGCTACTACTCGG - Intergenic
967058950 3:185854431-185854453 CTGTAGTCCCAGCTACTACTCGG + Intergenic
967061009 3:185872691-185872713 CTGTAATCCCAGCTACTCCTCGG - Intergenic
967880507 3:194298101-194298123 CTGTAATCCCAGCAACTCTTGGG + Intergenic
967919085 3:194601258-194601280 CTGTAATCCCAGCTACTACTGGG - Intronic
968033476 3:195524397-195524419 CTGTAATCCCAGCTACTACTGGG + Intronic
968359469 3:198137254-198137276 CTCTGACCTCTGCAGCTACTCGG + Intergenic
968875806 4:3267382-3267404 CTGTAATCCCAGCTACTCCTCGG + Intronic
968994930 4:3939294-3939316 CTGTAATCCCATAATCTACTCGG - Intergenic
969011609 4:4068443-4068465 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
969014693 4:4096087-4096109 CTATAAACACAGCAGGTACTAGG + Intergenic
969739248 4:9012353-9012375 CTATAAACACAGCAGGTACTAGG - Intergenic
969742465 4:9041442-9041464 CTGTAGTCCCAGCAGCTACTCGG - Intergenic
969784232 4:9441044-9441066 CTGCAACTCCAGCAGCCACTTGG + Intergenic
969798432 4:9543866-9543888 CTATAAACACAGCAGGTACTAGG - Intergenic
969808155 4:9626933-9626955 TTGCACCCCCAGCAGGTACTTGG - Intergenic
969928252 4:10605567-10605589 CTGTAATCCCAGCAGCACTTTGG + Intronic
970768929 4:19586246-19586268 CTGTAATCCCAGCTACTCCTGGG - Intergenic
971337744 4:25739580-25739602 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
972400876 4:38702447-38702469 CTGTAATTCCAGCAACTACGGGG - Intergenic
972602270 4:40583167-40583189 CTGTAATTCCAGCATTTACTGGG + Intronic
972611772 4:40662387-40662409 CTGTAATCCCAGCTACTAGTGGG - Intergenic
974716141 4:65670389-65670411 CGGGAACCGCAGCAGCTCCTGGG - Intronic
974759881 4:66261300-66261322 CTGTAATCCCAGCTACTCCTGGG - Intergenic
975344452 4:73277900-73277922 CTGTAATCCCAGCTACTACTCGG - Intergenic
975385955 4:73760624-73760646 CTGTAATCCCAGCTACTACCTGG + Intergenic
975660253 4:76681540-76681562 CTGCAACCCCAGGAGCTAGAGGG - Intronic
975978003 4:80121148-80121170 CTGTAGTCCCAGCTGCTACTCGG + Intronic
976025611 4:80684523-80684545 CTGTAATCCCAGCAGCACTTTGG - Intronic
976338767 4:83921470-83921492 CTGTAAGCCCAGCTACTACTTGG - Intergenic
976439964 4:85061684-85061706 CTGGAGCCCCAGCAGCCACCAGG - Intergenic
976542809 4:86297433-86297455 CAGTAATCCCAGCAGCTACTCGG - Intronic
976777364 4:88721163-88721185 CTGTAACCCCATTCCCTACTGGG + Intergenic
977939578 4:102844333-102844355 CTGTAACCCCAGCACTTAGGGGG - Intronic
979304791 4:119130082-119130104 CTGTAATTCCAGCAGCTACTCGG - Intergenic
981103749 4:140857679-140857701 CTGTAATCCCAGCTCCTCCTCGG + Intergenic
981207619 4:142062473-142062495 CTGTAATCCCAGCAGCACTTTGG + Intronic
981487376 4:145301535-145301557 TTAAAACCCCAGCAGCTTCTGGG + Intergenic
981634079 4:146855034-146855056 CTGTAATCCCAGCAGCACTTTGG + Intronic
982174656 4:152694353-152694375 CTGTAATCCCAGCTACTACTTGG + Intronic
982697323 4:158616874-158616896 CTGTAACCCCAGCTGCTCGGAGG + Intronic
984007482 4:174330364-174330386 CTGTAATCCCAGCTACTAGTGGG + Intronic
984083929 4:175284871-175284893 CTGTAATCCCAGCTACCACTTGG - Intergenic
988798515 5:34674708-34674730 CTGTAATCCTAGCTACTACTCGG - Intronic
989597710 5:43172003-43172025 CTGTAATCCCAGCAGCACTTTGG - Intronic
990557128 5:56948541-56948563 CTGTAATACCACCAGCTACGTGG + Intronic
990576131 5:57125200-57125222 CTGTAATCCCAGCTACTAGTCGG - Intergenic
991058519 5:62345422-62345444 CTGTAATCCCAGCTGCTACTTGG + Intronic
991067717 5:62441635-62441657 CTATAATCCCAGCTGCTAGTAGG - Intronic
992437247 5:76766505-76766527 CTGTAATCCCAGCTACTACTCGG + Intergenic
992448895 5:76857892-76857914 ATGTAACTCCATGAGCTACTAGG + Intronic
992563395 5:77974019-77974041 CTGTAGTCCCAGCTACTACTAGG - Intergenic
992782131 5:80137514-80137536 CTGTAGTCCCAGCTGCTACTCGG + Intronic
993076826 5:83242569-83242591 CTGTAGACCAAACAGCTACTTGG - Intronic
993256917 5:85603790-85603812 CTGTTACCCTAGCAGGTCCTGGG + Intergenic
993907536 5:93640186-93640208 CTGTAATCCCAGCAGCACTTTGG + Intronic
995838882 5:116424490-116424512 CTGTAATCCCAGCAGCACTTTGG + Intergenic
996032498 5:118721569-118721591 CTGTAATCCCAGCTACTCCTTGG + Intergenic
996176015 5:120358854-120358876 CTGTAATCCCAGCACTTTCTGGG - Intergenic
997124597 5:131213065-131213087 CTGTAATCCCAGCTACTACACGG + Intergenic
997280140 5:132637653-132637675 CTGTAATTCCAGCTACTACTCGG - Intronic
997511941 5:134460156-134460178 CTGTAATCCCAGCTACTAGTGGG + Intergenic
998128726 5:139640538-139640560 CTCTGACCCCAGCAGAAACTGGG + Intergenic
1000078148 5:157814771-157814793 CTGTAACCCCAGCACTTCCTGGG + Intronic
1000314108 5:160072468-160072490 CTGTAATCCCAGCACCTGCGGGG + Intronic
1000340850 5:160276135-160276157 CTGTAACCCCAGCACTTTGTGGG + Intronic
1000597446 5:163232213-163232235 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1001408260 5:171492158-171492180 CTGTAATCCCAGCTACTACTAGG - Intergenic
1001766159 5:174248872-174248894 CTGTAATCCCAGCAGTTTGTGGG + Intergenic
1001822562 5:174721260-174721282 TTGTAACCCCAGCGGCTAGAAGG - Intergenic
1001919895 5:175591465-175591487 CTGTAATCCCAGCCGCTCCTGGG + Intergenic
1004210129 6:13632020-13632042 CTGTAAAATCAGCAGTTACTAGG - Intronic
1004359399 6:14957621-14957643 CTGTAATCCCAGCACTTTCTAGG + Intergenic
1004451034 6:15746732-15746754 CTGTAATCCCAGCTACTACTTGG + Intergenic
1004484170 6:16049947-16049969 CTGTTTCCCCAGGAGCTCCTTGG + Intergenic
1005450334 6:25965793-25965815 CTGTAGACCCAGCTACTACTCGG + Intronic
1005745462 6:28833022-28833044 CTGTAACCCCAGCTGCTCAGAGG + Intergenic
1006246103 6:32737896-32737918 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1006762476 6:36475321-36475343 CTATAATCCCAGCTGCTACTTGG + Intronic
1006966266 6:37989027-37989049 CTGTAATCCCAGCTACTACTGGG - Intronic
1007011159 6:38418850-38418872 CTATAGTCCCAGCAGCTATTTGG + Intronic
1008680644 6:53868345-53868367 CTGTAATCCCAGCTACTTCTCGG - Intronic
1009882260 6:69583393-69583415 TTGTAATCCCAACAGCTACTCGG + Intergenic
1010792912 6:80085370-80085392 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1011190698 6:84725263-84725285 CTGTTGACCCAGCAGCTAGTGGG - Intronic
1011618965 6:89224212-89224234 CTGTAATCCCAGCTACTACTTGG - Intronic
1011644532 6:89445391-89445413 CTGTAATCCCAGCTACTAGTGGG - Intronic
1011772835 6:90693971-90693993 CTATAATCCCAGCTACTACTAGG + Intergenic
1012280521 6:97322465-97322487 ATGAAAGCCCAGCAGATACTAGG - Intergenic
1013234115 6:108182114-108182136 CTGTAGTCCCAGCAGCTACTCGG + Intronic
1013531269 6:111020907-111020929 CTGTAATCCCAGCAGCCCTTTGG + Intronic
1014726879 6:124981903-124981925 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1015105927 6:129536744-129536766 CTGTAACCCCTCCTGGTACTGGG + Intergenic
1016172019 6:141029765-141029787 CTGTAATCCCACCTCCTACTTGG + Intergenic
1016280970 6:142418170-142418192 CTATAATCCCAGCTACTACTCGG + Intronic
1016739447 6:147512078-147512100 CTGTAATCCCAGGTACTACTTGG - Intronic
1017238224 6:152139446-152139468 CTGTAATCCCAGCTACTAGTGGG + Intronic
1017705592 6:157119738-157119760 CTGTAATCCCAGCTGTTAATGGG - Intronic
1019031656 6:169018715-169018737 CTGTCACTGCAGCCGCTACTGGG + Intergenic
1019705466 7:2495283-2495305 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
1019758070 7:2788030-2788052 CTGTAATCCCAGCTGCTCGTGGG + Intronic
1020036319 7:4965306-4965328 CTGTAGTCCCCACAGCTACTGGG + Intergenic
1020986493 7:15141458-15141480 CTGTAGTCCCCCCAGCTACTTGG + Intergenic
1021213690 7:17888708-17888730 CTGTATCCCCAGCATCTGGTTGG + Intronic
1021446961 7:20744188-20744210 CTGTAATCTCAGCTACTACTTGG - Intronic
1021488842 7:21196626-21196648 CTGTAATCCCAACTACTACTGGG - Intergenic
1022011744 7:26313930-26313952 CTGTAGCCTCCCCAGCTACTCGG - Intronic
1022535132 7:31093782-31093804 CTGTGACCCCAGCATCTACTGGG - Intronic
1022771107 7:33473580-33473602 CTGTAATCCCAGCAGCACTTTGG - Intronic
1023431065 7:40091396-40091418 CTGTAATCCCAGCTCCTAGTGGG + Intronic
1023679372 7:42668916-42668938 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1024382209 7:48710189-48710211 CTGGGTCCCCACCAGCTACTGGG + Intergenic
1024968115 7:55043482-55043504 CTGTAATCCCAGCTACTACTTGG - Intronic
1026218981 7:68375083-68375105 CTGTAATCCCAGCTACTCCTAGG + Intergenic
1026232045 7:68493395-68493417 CTGCAGCACCAGCAGCAACTGGG - Intergenic
1026742297 7:72986435-72986457 CTGTAATCCCTCCTGCTACTCGG - Intergenic
1026802145 7:73406857-73406879 CTGTAATCCCTCCTGCTACTCGG - Intergenic
1027028418 7:74871169-74871191 CTGTAATCCCTCCTGCTACTCGG - Intergenic
1027101438 7:75378643-75378665 CTGTAATCCCTCCTGCTACTCGG + Intergenic
1029073365 7:97917717-97917739 CTATAAACACAGCAGGTACTAGG + Intergenic
1029227219 7:99036940-99036962 TGGGAACCCCAGCAGCTCCTAGG + Intronic
1029260950 7:99302439-99302461 CCATAATCCCAGCTGCTACTTGG + Intergenic
1029369871 7:100142456-100142478 CTGTAATCCCAGCAGGTGGTAGG + Intergenic
1029730936 7:102437658-102437680 CTGTGAAACTAGCAGCTACTTGG + Intronic
1030171460 7:106606964-106606986 CTGTAGTCCCAGAAACTACTTGG - Intergenic
1031323792 7:120366360-120366382 CTGTATTCTCAGCTGCTACTTGG + Intronic
1031929707 7:127672485-127672507 CTGTAGTCCCAGCTACTACTCGG + Intronic
1032218173 7:129973488-129973510 CTGTAGCCCCAGCTGCTAGGGGG - Intergenic
1032821405 7:135527481-135527503 TTGTAGTCCCAGCAGCTACGAGG + Intergenic
1033110065 7:138565498-138565520 CTGTGACCCCAGGCGCCACTGGG - Intronic
1033239737 7:139667865-139667887 CTGTAATCCCAGCAGCACTTTGG + Intronic
1033286321 7:140043651-140043673 CTGTAATCCCAGCTACTCCTCGG - Intronic
1033340259 7:140486436-140486458 CTGTAATCCCAGCTGCTCCCAGG - Intergenic
1033562684 7:142547517-142547539 CTGTGGTCCCAGCAGCTACTCGG + Intergenic
1034023918 7:147676316-147676338 CTGTAACCCTAGCAGGTTTTAGG - Intronic
1034139019 7:148799311-148799333 CTGAAACACCAGCAGTTACTTGG + Exonic
1034355502 7:150448059-150448081 CTGTAATCCCAGCACTTCCTGGG - Intergenic
1034427384 7:151021229-151021251 CTGCAACCTCTTCAGCTACTGGG - Exonic
1035000995 7:155611942-155611964 CTGTAAACCCAGCACATATTGGG - Intronic
1035262332 7:157669954-157669976 CTGTACCCACAGCATCTACGTGG + Intronic
1036256420 8:7210166-7210188 CTATAAACACAGCAGGTACTAGG + Intergenic
1036308470 8:7668751-7668773 CTATAAACACAGCAGGTACTAGG + Intergenic
1036361064 8:8077326-8077348 CTATAAACACAGCAGGTACTAGG - Intergenic
1036834809 8:12053083-12053105 CTGCAACTCCAGCAGCCACTTGG - Intergenic
1036856652 8:12299647-12299669 CTGCAACTCCAGCAGCCACTTGG - Intergenic
1036886588 8:12559723-12559745 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
1036889899 8:12589675-12589697 CTATAAACACAGCAGGTACTAGG + Intergenic
1036894199 8:12618803-12618825 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
1036897506 8:12647836-12647858 CTATAAACACAGCAGGTACTAGG + Intergenic
1037314438 8:17587751-17587773 CTGTAATCCCAGCTACCACTCGG - Intronic
1038708180 8:29915755-29915777 CTGTAGCCCCAGCTGCTACTTGG - Intergenic
1039059428 8:33561801-33561823 CTGTAATCCCAGCACTTTCTTGG - Intronic
1039811493 8:41053330-41053352 CTGTAACCCCAGCTACTCCGGGG + Intergenic
1040516374 8:48138442-48138464 CTATAGTCCCAGCAGCTACTTGG + Intergenic
1041055828 8:53985137-53985159 TTATAATCGCAGCAGCTACTCGG - Intronic
1041757466 8:61330207-61330229 CTGTAACAGCAGCTGCTCCTTGG - Intronic
1042285896 8:67109821-67109843 CTGTAACCCCGCCATCCACTTGG - Intronic
1042355792 8:67826016-67826038 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1042542032 8:69916956-69916978 CTGTAGTCTCAGCTGCTACTTGG + Intergenic
1042918999 8:73903281-73903303 CTATAATTCCAACAGCTACTTGG - Intergenic
1044026520 8:87179031-87179053 CTGTAGTCTCAGCTGCTACTTGG - Intronic
1044668515 8:94655213-94655235 CTGTAATTCCAGCAGTTACTTGG - Intronic
1044982898 8:97733966-97733988 CTGTAACTCCAGCTGCTAATAGG + Intergenic
1045385834 8:101670220-101670242 AGGAAACCCCAGCAGATACTGGG - Intergenic
1046006831 8:108496410-108496432 CTGTAACCCCAGCTACTACTTGG - Intergenic
1046313398 8:112468332-112468354 CTCTTACTCCAGCAGATACTGGG - Intronic
1047256448 8:123216846-123216868 CTGTAATCCCAACAACTACTTGG + Intergenic
1047257021 8:123221781-123221803 CTATAGTCCCAGCAACTACTTGG + Intronic
1047273644 8:123388319-123388341 CTGTAGCCCCAGCTACTACCGGG - Intronic
1047413634 8:124645265-124645287 CTGTAGTCCTAGTAGCTACTCGG + Intronic
1047424582 8:124733752-124733774 CTCTAACCCCATCATCCACTGGG + Intergenic
1047535634 8:125717250-125717272 TGGTCACCCCAGCAGCTCCTTGG - Intergenic
1047588898 8:126304784-126304806 CTGTTACCCCAGCACCTGCAGGG - Intergenic
1047976005 8:130131504-130131526 CTGTAATCCCAGCACTTTCTGGG + Intronic
1047985600 8:130229937-130229959 CTGTGGTCCCAGCTGCTACTCGG + Intronic
1048838818 8:138546846-138546868 CTGTAATCCCAGCTACTCCTTGG - Intergenic
1048932098 8:139323394-139323416 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1049574971 8:143385738-143385760 CTGTGGCCGCAGCAGCTCCTGGG - Intergenic
1049608153 8:143539253-143539275 CTGGTACCCCAGCAGCTTCTGGG - Exonic
1050367888 9:4889376-4889398 CTATAATCCCAGCTACTACTCGG + Intergenic
1050516658 9:6451601-6451623 CTGTAGTCCCAGCTACTACTCGG - Intronic
1050841739 9:10158263-10158285 CTGTAACCCCAACAACTTCAGGG - Intronic
1050965454 9:11795742-11795764 CTTTTTCCCCAGAAGCTACTTGG + Intergenic
1051756459 9:20406147-20406169 CTGTACCCCCAGCAGCTTCTTGG + Intronic
1052756492 9:32547955-32547977 CTGTAATCCCAGCTACTACTGGG - Intronic
1052918043 9:33939320-33939342 CTGTAGTCCCAGCTACTACTTGG - Intronic
1053028692 9:34755768-34755790 CTGCAATCCCAGCTGCTATTGGG - Intergenic
1053435392 9:38070223-38070245 CTGTAATCCCAGCAGCTACTCGG + Intergenic
1054729494 9:68686371-68686393 CTGTAATCCCAGCTACTACTTGG + Intergenic
1055123637 9:72692591-72692613 CACAAACCCAAGCAGCTACTTGG - Intronic
1055703796 9:78975540-78975562 CTGTAATCCCAGCTACTCCTTGG - Intergenic
1056988945 9:91391665-91391687 CTGTGACCTCTGCAACTACTTGG - Intergenic
1057238418 9:93386334-93386356 CTGTAATCCCAGCTACTACTCGG + Intergenic
1057341409 9:94205136-94205158 CTGTATTCCCAGCTACTACTTGG + Intergenic
1057587039 9:96337857-96337879 CTGTAATCCCAGCTACTACAGGG + Intronic
1058315590 9:103561386-103561408 CTGTAGTCCCAGCTGCTCCTCGG - Intergenic
1058405071 9:104663562-104663584 CTGTAATCCCAGCTCCTGCTGGG + Intergenic
1058596703 9:106622802-106622824 CAGTAAGCCCACCAGCTGCTAGG - Intergenic
1058610046 9:106765700-106765722 CTGTAATCCCAGCAACTTGTGGG + Intergenic
1058677309 9:107411335-107411357 CTGTAATCCCAGCTACTACTCGG - Intergenic
1059451467 9:114373616-114373638 CTGTAATCCCAGCAGCACTTTGG + Intronic
1059461891 9:114436569-114436591 CTGTAATCCCAGCACCTTGTGGG + Intronic
1060582279 9:124760187-124760209 CTGTAATCCCAGCTGCTCCAGGG + Intronic
1060611582 9:124970595-124970617 CTATAATCCCAGCTACTACTTGG + Intronic
1060674628 9:125502222-125502244 CTGTAATCCCAGCTGCTAGGGGG - Intronic
1061339088 9:129964466-129964488 CTGTCACCCCAGAAACTATTAGG - Intronic
1061407281 9:130399467-130399489 CTGTCAGCCCAGCAGCCACTTGG + Intronic
1061527520 9:131179120-131179142 CTGTAGTCCCAGCAGCTACTTGG - Intronic
1061981425 9:134106215-134106237 TTGTAATCCCAGCTACTACTGGG + Intergenic
1061981656 9:134108124-134108146 TTGTAATCCCAGCTACTACTAGG + Intergenic
1062223746 9:135436796-135436818 CTGTAATCCCAGCTACTACTAGG + Intergenic
1185807413 X:3071424-3071446 CTGTAATCCCAGCTGCTAGGGGG - Intronic
1186282574 X:8009302-8009324 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1186868833 X:13748994-13749016 CTGTAGTGCCTGCAGCTACTCGG + Intronic
1187520512 X:20009733-20009755 CTGTAATCCCAGTAAGTACTTGG + Intronic
1187622943 X:21078881-21078903 CTGTCTCCCAAGCAGCTGCTGGG + Intergenic
1187746508 X:22414936-22414958 CTTTAACCCCAGCACCTAGTAGG - Intergenic
1188000168 X:24973233-24973255 CTGTAATCCTAGCTACTACTTGG + Intronic
1188539282 X:31231755-31231777 CTGTAATCCCAGCTACTACCTGG + Intronic
1188645616 X:32563215-32563237 CTGTAGTCCCAGCTGCTACTTGG + Intronic
1189117727 X:38360041-38360063 CTGTAATCCCAGCTACTCCTTGG - Intronic
1189339382 X:40193054-40193076 CTGTAATCCCAGCAGCACTTTGG + Intergenic
1189820694 X:44867868-44867890 CTGTAATCCCAGCTACTACTTGG - Intergenic
1189824371 X:44902102-44902124 CTGTAGTCCCAGCTACTACTTGG + Intronic
1189914383 X:45842409-45842431 TTATACCCCCAGCAACTACTGGG - Intergenic
1190246218 X:48692174-48692196 CTGTAATCCCAGCTCCTAATGGG + Intergenic
1190272352 X:48875799-48875821 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1190864819 X:54375621-54375643 CTGTAATCCCAGCTGCTCCGGGG - Intergenic
1192780659 X:74291327-74291349 CTGTAACCCCAGCTACTACTTGG + Intergenic
1194688280 X:96951586-96951608 CTGTAATCCCAGCTACTCCTTGG - Intronic
1195628079 X:107024299-107024321 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1196799901 X:119533066-119533088 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1197208072 X:123806915-123806937 CTGTAACCCCAGCTACTTGTGGG + Intergenic
1197752121 X:129971997-129972019 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1198179764 X:134194919-134194941 TTGTAATCCCAGCTGCTACTCGG + Intergenic
1198340889 X:135712651-135712673 CTGTAGTCCCAACAGCTACTTGG - Intergenic
1198347047 X:135768870-135768892 CTATAATCCCACCAGCTACTTGG + Intergenic
1198348953 X:135786139-135786161 CTATAATCCCACCAGCTACTTGG + Intergenic
1198350859 X:135803423-135803445 CTATAATCCCACCAGCTACTTGG + Intergenic
1198352765 X:135820676-135820698 CTATAATCCCACCAGCTACTTGG + Intergenic
1198354674 X:135837944-135837966 CTATAATCCCACCAGCTACTTGG + Intergenic
1198356585 X:135855211-135855233 CTATAATCCCACCAGCTACTTGG + Intergenic
1198358498 X:135872487-135872509 CTATAATCCCACCAGCTACTTGG + Intergenic
1199578981 X:149342738-149342760 CTGTAATCCCAGCAGCACTTTGG - Intergenic
1199608099 X:149592732-149592754 GTGCAGCCCCAGCAGCCACTAGG + Exonic
1199631021 X:149776628-149776650 GTGCAGCCCCAGCAGCCACTAGG - Exonic
1199777591 X:151028983-151029005 CTGTAATCTCAGCTACTACTTGG + Intergenic
1202147864 Y:21819471-21819493 CTGTAATCCCAGCAGCTGGGGGG + Intergenic