ID: 1102003758

View in Genome Browser
Species Human (GRCh38)
Location 12:109575357-109575379
Sequence CTATATACCTTGGTAGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102003758 Original CRISPR CTATATACCTTGGTAGAGCT TGG Intronic
905835852 1:41120090-41120112 CTATACACCTTGGTATAGGGAGG + Intronic
906025421 1:42669466-42669488 TTATATTTCTTGGTAGAGATGGG + Intronic
909921682 1:81388915-81388937 CTATCTACCTACGTTGAGCTGGG - Intronic
909939167 1:81590648-81590670 CTATGTTCCTTAGGAGAGCTTGG - Intronic
910849331 1:91635548-91635570 CCATTTACCTTGGGGGAGCTTGG - Intergenic
924407009 1:243758594-243758616 CCATAGACCTTGGAAGAGGTAGG + Intronic
924479386 1:244413961-244413983 CTATAGATCTTGGCAGAGCTTGG - Intronic
1066628880 10:37438886-37438908 ATATATATATTGGTAGAGGTGGG + Intergenic
1067784796 10:49237590-49237612 CTATAGACCTTGGCAGAGACAGG - Intergenic
1068129428 10:52879052-52879074 TTATGTACCTTGGGAGGGCTGGG + Intergenic
1071357120 10:84809287-84809309 TTATATACTGGGGTAGAGCTAGG + Intergenic
1072989302 10:100175757-100175779 TTATATAACTTGTTAGAGATTGG - Intronic
1079250984 11:18787795-18787817 CTGTCTCCCCTGGTAGAGCTTGG + Intronic
1082115874 11:48327727-48327749 CTATATACCTCAATAAAGCTGGG + Intronic
1082257816 11:50051771-50051793 CTATATACCTCAATAAAGCTGGG - Intergenic
1083373846 11:62203903-62203925 CAATTTACCTTAGTAAAGCTGGG + Intergenic
1083518271 11:63281564-63281586 CTAAATATCTTGGTAGACATGGG + Intronic
1088050466 11:105508245-105508267 CTATATTCCTTGATAGATATAGG - Intergenic
1088458217 11:110054727-110054749 CTGTATATTTTGGTAGAGATGGG - Intergenic
1093509857 12:19913702-19913724 GTATATACCTTGGTGGTCCTAGG + Intergenic
1099195539 12:79610242-79610264 CTATGCAGCTTGGTTGAGCTGGG + Intronic
1099696866 12:86034339-86034361 CTTTATACATTGGTAGAATTTGG + Intronic
1101463927 12:104927717-104927739 CTACAGACCTTGGAAGAGCTTGG - Intronic
1102003758 12:109575357-109575379 CTATATACCTTGGTAGAGCTTGG + Intronic
1103210671 12:119164031-119164053 CTATACACCTTGTTGGTGCTTGG + Intergenic
1104190720 12:126479793-126479815 ATATATATTTTGGTAGAGATGGG + Intergenic
1106817178 13:33421499-33421521 CTTTGTACCTTGGTAGAGTTCGG - Intergenic
1107842968 13:44478715-44478737 CTAGATACCGTGGTAGAGTGTGG - Intronic
1110490728 13:76102575-76102597 ATATACTCCTTGGTAGAACTAGG + Intergenic
1112821615 13:103344414-103344436 CTAAATACCTTGCTACAGTTGGG + Intergenic
1114364160 14:22009159-22009181 CTATAAACATGGGAAGAGCTGGG + Intergenic
1115705772 14:35996541-35996563 ATTTATACCTTAATAGAGCTGGG - Intergenic
1120226986 14:81801786-81801808 TTCTATACCTTGGTAGAGTTTGG + Intergenic
1124653731 15:31490812-31490834 TTTTATTCCTTGGTAGAGGTAGG - Intronic
1129437894 15:75556990-75557012 CTATATACCATGATGGACCTTGG - Intronic
1131083035 15:89553186-89553208 CTCTATATCTTGGTAGGGATTGG - Intergenic
1132334348 15:101036123-101036145 CTAAATACCTTGCTAGACGTAGG + Intronic
1136606009 16:31334240-31334262 CTTTAGACCTAGGCAGAGCTGGG - Intergenic
1136655958 16:31709397-31709419 CTATATCCCTGGGTGGAGCTGGG + Intergenic
1139361362 16:66402171-66402193 CTATATACATAAGTAAAGCTGGG - Intronic
1139669409 16:68481972-68481994 GTAAATACGTGGGTAGAGCTAGG - Intergenic
1143055267 17:4157635-4157657 CCAGTTACCTTGTTAGAGCTGGG - Exonic
1148274067 17:46288024-46288046 AGAAATGCCTTGGTAGAGCTAGG - Intronic
1150408987 17:64926553-64926575 AGAAATGCCTTGGTAGAGCTAGG + Intergenic
1156992985 18:43432594-43432616 CTGAATAACTTGGCAGAGCTAGG + Intergenic
1158937134 18:62375165-62375187 CTATACACCTTGGGAGGCCTAGG - Intronic
930781709 2:55230261-55230283 TTATCTACCTTGGCAGATCTTGG - Intronic
931166671 2:59756275-59756297 CTATATATCTTGATAGAGTATGG - Intergenic
937184719 2:120029484-120029506 TTATATACATAGGTAGAGATGGG + Intronic
937523530 2:122739700-122739722 CTGTATTCCCTGGTATAGCTGGG - Intergenic
940308619 2:152253290-152253312 CTATACACCTGGGAAGAGTTGGG + Intergenic
942768460 2:179485860-179485882 CTATAGACCTTGGGTGACCTGGG - Intronic
1175070259 20:56327159-56327181 CTACTTACCTTGGGAGATCTAGG - Intergenic
1181868701 22:25880649-25880671 CTGGACACCTTGATAGAGCTAGG + Intronic
951184490 3:19696931-19696953 CCATATACCTTAATACAGCTTGG + Intergenic
953845654 3:46424151-46424173 CTATATTTTTTGGTAGAGATGGG + Intergenic
954769212 3:52950939-52950961 ATATATATTTTGGTAGAGATGGG - Intronic
957436535 3:80184410-80184432 CTAAATAGCATTGTAGAGCTAGG + Intergenic
963441910 3:145350894-145350916 CTATATACTTTATTATAGCTGGG + Intergenic
964602887 3:158522241-158522263 ATATATTCCTTGATACAGCTTGG + Intronic
966557087 3:181274815-181274837 CTATATACCTTATTAAAACTTGG - Intergenic
972802088 4:42487299-42487321 CTTTATCCCTTTGAAGAGCTGGG - Intronic
979551815 4:121999479-121999501 CTGAATAACTGGGTAGAGCTGGG + Intergenic
980782330 4:137507690-137507712 CTATAGACATTGGTAGAATTGGG + Intergenic
981383710 4:144102589-144102611 CAAAACACATTGGTAGAGCTGGG - Intergenic
982724631 4:158892658-158892680 GCATATAGCTGGGTAGAGCTTGG + Intronic
987716166 5:21574484-21574506 GTATATATCCTGGTAGAGCTAGG + Intergenic
988265613 5:28945681-28945703 TTGTAAACCTTAGTAGAGCTAGG - Intergenic
988644328 5:33077602-33077624 CTATGGATCTTGGTAGAGGTTGG + Intergenic
990486282 5:56261914-56261936 CTTTAAACTTTGGTAGAACTTGG - Intergenic
993372066 5:87105090-87105112 CTACATACTGTGCTAGAGCTGGG + Intergenic
1002379994 5:178820205-178820227 ATATATATTTTGGTAGAGATGGG + Intergenic
1005850505 6:29817273-29817295 GGATCTACCTTGGTAGGGCTGGG - Intergenic
1010269237 6:73902440-73902462 CTAAATACCTTGCTAGACTTGGG - Intergenic
1012423661 6:99091804-99091826 CCATATGCCTTTGCAGAGCTTGG + Intergenic
1015364504 6:132383002-132383024 GAATAGACCTTGGTTGAGCTTGG + Intronic
1018847357 6:167564934-167564956 CTATATGCCTTGGCTGACCTTGG - Intergenic
1021261086 7:18458407-18458429 CTATATTTATTGGTATAGCTTGG - Intronic
1022603483 7:31784721-31784743 CTATTTTCATTTGTAGAGCTTGG - Intronic
1023320176 7:38988308-38988330 CTATTTATCTGGGTGGAGCTTGG + Intronic
1024862817 7:53865337-53865359 ATATATACTTGGGTAGAGATTGG + Intergenic
1026153405 7:67807466-67807488 CTGCAAACCTTGGCAGAGCTGGG + Intergenic
1026275287 7:68871005-68871027 TTATATTCCTTTGTAGAGATGGG - Intergenic
1026339141 7:69420457-69420479 ATATATTTTTTGGTAGAGCTGGG - Intergenic
1026552625 7:71381131-71381153 TTATATTTCTTGGTAGAGGTGGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1043966572 8:86484360-86484382 CTACATTGCTTGGTATAGCTGGG - Intronic
1049152714 8:141045753-141045775 ACATATAAATTGGTAGAGCTGGG - Intergenic
1051621515 9:19054658-19054680 ATATATACTTGGGTAGAGATTGG - Exonic
1055158153 9:73089911-73089933 CTGCATACCTTTCTAGAGCTTGG - Intergenic
1057011215 9:91603413-91603435 CTATATATCTGGGTAAAGCATGG - Intronic
1057607321 9:96508742-96508764 CAAGAGACCTTGGCAGAGCTGGG - Intronic
1059905718 9:118983492-118983514 CTATATACCTTGGTATTCCCTGG - Intergenic
1060890366 9:127184152-127184174 TTATATACTTTTGTAGAGATGGG - Intronic
1061006136 9:127929366-127929388 CCATATACCCTGGCAGGGCTGGG + Intronic
1187435103 X:19260720-19260742 CCATATACCCTGGCATAGCTAGG - Intergenic
1193758227 X:85435090-85435112 CCACATACCTTGGTATAGTTTGG + Intergenic
1195643159 X:107199830-107199852 CTTTATATCTTGGTAGAACAAGG - Intronic
1197009373 X:121542302-121542324 CTATATCCAGTGGTAGAGCAGGG + Intergenic
1197196125 X:123702464-123702486 ATATATATATTGGTAGAGATGGG - Intronic
1198486594 X:137093444-137093466 TTCTATACCTTGGTAAAGTTTGG + Intergenic