ID: 1102006981

View in Genome Browser
Species Human (GRCh38)
Location 12:109595406-109595428
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 308}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102006981_1102006994 26 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006994 12:109595455-109595477 GGGGCTGTCCGCACAAGCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1102006981_1102006990 6 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006990 12:109595435-109595457 TGGCTGGGGCTCCTGTCATCGGG 0: 1
1: 1
2: 4
3: 31
4: 259
1102006981_1102006993 25 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006993 12:109595454-109595476 CGGGGCTGTCCGCACAAGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 53
1102006981_1102006986 -10 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006986 12:109595419-109595441 GTGCAGGGCTGGGCTGTGGCTGG 0: 1
1: 2
2: 11
3: 121
4: 946
1102006981_1102006991 7 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006991 12:109595436-109595458 GGCTGGGGCTCCTGTCATCGGGG 0: 1
1: 0
2: 2
3: 14
4: 174
1102006981_1102006989 5 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006989 12:109595434-109595456 GTGGCTGGGGCTCCTGTCATCGG 0: 1
1: 0
2: 1
3: 14
4: 260
1102006981_1102006987 -9 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006987 12:109595420-109595442 TGCAGGGCTGGGCTGTGGCTGGG 0: 1
1: 1
2: 14
3: 112
4: 785
1102006981_1102006988 -8 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006988 12:109595421-109595443 GCAGGGCTGGGCTGTGGCTGGGG 0: 1
1: 0
2: 21
3: 196
4: 1276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102006981 Original CRISPR AGCCCTGCACCAGGCTCTCT AGG (reversed) Intronic