ID: 1102006984

View in Genome Browser
Species Human (GRCh38)
Location 12:109595415-109595437
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 0, 2: 9, 3: 99, 4: 684}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102006984_1102006991 -2 Left 1102006984 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG 0: 1
1: 0
2: 9
3: 99
4: 684
Right 1102006991 12:109595436-109595458 GGCTGGGGCTCCTGTCATCGGGG 0: 1
1: 0
2: 2
3: 14
4: 174
1102006984_1102006996 28 Left 1102006984 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG 0: 1
1: 0
2: 9
3: 99
4: 684
Right 1102006996 12:109595466-109595488 CACAAGCTTGGGAAGTAACCAGG 0: 1
1: 0
2: 0
3: 9
4: 106
1102006984_1102006993 16 Left 1102006984 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG 0: 1
1: 0
2: 9
3: 99
4: 684
Right 1102006993 12:109595454-109595476 CGGGGCTGTCCGCACAAGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 53
1102006984_1102006994 17 Left 1102006984 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG 0: 1
1: 0
2: 9
3: 99
4: 684
Right 1102006994 12:109595455-109595477 GGGGCTGTCCGCACAAGCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1102006984_1102006989 -4 Left 1102006984 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG 0: 1
1: 0
2: 9
3: 99
4: 684
Right 1102006989 12:109595434-109595456 GTGGCTGGGGCTCCTGTCATCGG 0: 1
1: 0
2: 1
3: 14
4: 260
1102006984_1102006997 29 Left 1102006984 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG 0: 1
1: 0
2: 9
3: 99
4: 684
Right 1102006997 12:109595467-109595489 ACAAGCTTGGGAAGTAACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 153
1102006984_1102006990 -3 Left 1102006984 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG 0: 1
1: 0
2: 9
3: 99
4: 684
Right 1102006990 12:109595435-109595457 TGGCTGGGGCTCCTGTCATCGGG 0: 1
1: 1
2: 4
3: 31
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102006984 Original CRISPR CCACAGCCCAGCCCTGCACC AGG (reversed) Intronic