ID: 1102006993

View in Genome Browser
Species Human (GRCh38)
Location 12:109595454-109595476
Sequence CGGGGCTGTCCGCACAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102006984_1102006993 16 Left 1102006984 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG 0: 1
1: 0
2: 9
3: 99
4: 684
Right 1102006993 12:109595454-109595476 CGGGGCTGTCCGCACAAGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 53
1102006981_1102006993 25 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006993 12:109595454-109595476 CGGGGCTGTCCGCACAAGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102006993 Original CRISPR CGGGGCTGTCCGCACAAGCT TGG Intronic
907952439 1:59196676-59196698 TGGGGATGTGAGCACAAGCTGGG - Intergenic
919748131 1:201021312-201021334 CGGGGCTGGGCGCTCATGCTGGG + Intronic
919824847 1:201496123-201496145 CGGGCCTGCCCCCACAGGCTGGG - Intronic
923451875 1:234125611-234125633 CAGGGCAGTCAGCACAAGCCCGG - Intronic
1071457327 10:85861088-85861110 CAGGGATGTCCCCAGAAGCTGGG + Intronic
1074266986 10:111914548-111914570 AGGGGCTGTCCCCATCAGCTAGG + Intergenic
1076816970 10:132919854-132919876 CGTGGCTGTCATCACAGGCTGGG + Intronic
1076980213 11:200097-200119 CGAGGCTGTCTTCACCAGCTGGG + Exonic
1078172225 11:8936926-8936948 CGGGGTTGACCGCATTAGCTAGG + Intergenic
1080659954 11:34287679-34287701 AGAGGCTCTCCGCACAAGCTAGG + Intronic
1083711947 11:64554983-64555005 CGGGGCTGGCCTCAGATGCTGGG + Intergenic
1090482058 11:127077651-127077673 CGAGTCTGTCCCCACAAGTTGGG - Intergenic
1094218602 12:27970630-27970652 CGGGGCAGTCCGCACGCCCTCGG - Intronic
1102006993 12:109595454-109595476 CGGGGCTGTCCGCACAAGCTTGG + Intronic
1104771402 12:131366860-131366882 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771480 12:131367130-131367152 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771497 12:131367184-131367206 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771514 12:131367238-131367260 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771530 12:131367292-131367314 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771562 12:131367400-131367422 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1104771576 12:131367453-131367475 CGGGGCACTCCACAGAAGCTGGG + Intergenic
1107164718 13:37270940-37270962 AGGGGCTGTCCTCACATTCTAGG - Intergenic
1114767894 14:25395180-25395202 CAGGGCTGTCAGCACTAGCGTGG + Intergenic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1117861020 14:60092471-60092493 CTTGGCTCTCCGCACAGGCTTGG - Intronic
1119264194 14:73254481-73254503 CAAGGCTGTCAGCAGAAGCTCGG - Intronic
1120110131 14:80544419-80544441 GGGGGCTGTCTACATAAGCTAGG - Intronic
1122971387 14:105153645-105153667 CGAGGCTGTCAGCAACAGCTGGG + Intronic
1123783120 15:23646036-23646058 CGGGGCCGGCAGCACAGGCTGGG + Exonic
1132058358 15:98669738-98669760 CGGGGCTGACTGCACAGCCTGGG - Intronic
1132465983 16:77698-77720 CGGGGGCCTCCGCACAAGCCTGG + Intronic
1132737379 16:1393678-1393700 GGGGTCTGTCCGCCCCAGCTCGG - Intronic
1137891341 16:52165910-52165932 CAGTGCTGTCAGCACAAGTTTGG + Intergenic
1138387147 16:56643522-56643544 CGGGGCTGTGCGCACCAGGCGGG - Intronic
1146062760 17:29615686-29615708 CGGGGCGGGGCGCACAAGCTCGG - Exonic
1147310888 17:39595662-39595684 CAGGGCTGGGCTCACAAGCTGGG + Intergenic
1154356576 18:13626428-13626450 CTGGGCTGTCCACACAGGCCAGG - Intronic
1161152686 19:2717911-2717933 TGGGGCTGTCCCCTCAAGCCTGG - Intronic
1161266582 19:3367163-3367185 CAGGGCGGCCCGCACAACCTTGG - Intronic
925923958 2:8657526-8657548 AGGGGCTGTCCTCAAGAGCTGGG + Intergenic
1170036242 20:11993124-11993146 CTGGGCTGTCAGCACCAGGTAGG + Intergenic
1175952768 20:62592261-62592283 GGGGGCTGTCTGCACCAGCTGGG - Intergenic
1181981354 22:26769088-26769110 AGGGGCTGTCTGCCCAGGCTGGG + Intergenic
949987724 3:9553405-9553427 GGGGGCTGTCCTCAGAAGCCAGG + Intronic
962165372 3:133041928-133041950 CAGGGCTGTCCACAGAAGATAGG + Intronic
962843101 3:139252873-139252895 CGGGGCTGTCCCCAGAAGAGGGG - Intronic
967106606 3:186259669-186259691 CGGGGCTGTCTGCATACTCTGGG - Intronic
994332779 5:98526844-98526866 AGGGGCTGTGGGCAGAAGCTGGG - Intergenic
997262684 5:132476596-132476618 TGAGGCAGGCCGCACAAGCTTGG + Intergenic
1005942507 6:30571382-30571404 CGGGGTTGGCCGCGCCAGCTTGG + Exonic
1019794953 7:3042808-3042830 CGGGGCTGCCCACACAAACTTGG - Intronic
1022675529 7:32495627-32495649 CGCGGCTTTCCGCACACGGTGGG + Exonic
1033974904 7:147089076-147089098 CCTGGCTGTCCGCCCAAGATGGG + Intronic
1049662849 8:143828128-143828150 CTGGGCTGCCCTCGCAAGCTGGG + Intronic
1050552384 9:6758895-6758917 CGGGGCTGTAGGCAGGAGCTTGG + Intronic
1061194201 9:129098620-129098642 CAGGGGAGACCGCACAAGCTCGG + Exonic
1062556946 9:137117360-137117382 CGGGGGTGTCTGCACAGGCATGG - Intergenic
1187281270 X:17860435-17860457 CCGGGGTGGCCGCACCAGCTCGG - Intronic