ID: 1102006993

View in Genome Browser
Species Human (GRCh38)
Location 12:109595454-109595476
Sequence CGGGGCTGTCCGCACAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102006981_1102006993 25 Left 1102006981 12:109595406-109595428 CCTAGAGAGCCTGGTGCAGGGCT 0: 1
1: 0
2: 4
3: 42
4: 308
Right 1102006993 12:109595454-109595476 CGGGGCTGTCCGCACAAGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 53
1102006984_1102006993 16 Left 1102006984 12:109595415-109595437 CCTGGTGCAGGGCTGGGCTGTGG 0: 1
1: 0
2: 9
3: 99
4: 684
Right 1102006993 12:109595454-109595476 CGGGGCTGTCCGCACAAGCTTGG 0: 1
1: 0
2: 0
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102006993 Original CRISPR CGGGGCTGTCCGCACAAGCT TGG Intronic