ID: 1102007315

View in Genome Browser
Species Human (GRCh38)
Location 12:109596979-109597001
Sequence GGACCGCCCCCTGTCTCTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102007308_1102007315 10 Left 1102007308 12:109596946-109596968 CCGGAGAAGTGTGCCTTCTCTCT 0: 1
1: 0
2: 0
3: 35
4: 260
Right 1102007315 12:109596979-109597001 GGACCGCCCCCTGTCTCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1102007306_1102007315 18 Left 1102007306 12:109596938-109596960 CCTGGTTCCCGGAGAAGTGTGCC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1102007315 12:109596979-109597001 GGACCGCCCCCTGTCTCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1102007307_1102007315 11 Left 1102007307 12:109596945-109596967 CCCGGAGAAGTGTGCCTTCTCTC 0: 1
1: 0
2: 1
3: 13
4: 202
Right 1102007315 12:109596979-109597001 GGACCGCCCCCTGTCTCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 93
1102007311_1102007315 -3 Left 1102007311 12:109596959-109596981 CCTTCTCTCTCCCTTTTCAGGGA 0: 1
1: 0
2: 7
3: 69
4: 626
Right 1102007315 12:109596979-109597001 GGACCGCCCCCTGTCTCTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102007315 Original CRISPR GGACCGCCCCCTGTCTCTCA GGG Exonic