ID: 1102007404

View in Genome Browser
Species Human (GRCh38)
Location 12:109597334-109597356
Sequence CTTCAGCAATGGAGGGAAAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 221}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102007393_1102007404 12 Left 1102007393 12:109597299-109597321 CCTGTCCCCTCTCCAGCTGTTTC 0: 1
1: 0
2: 4
3: 41
4: 637
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007396_1102007404 5 Left 1102007396 12:109597306-109597328 CCTCTCCAGCTGTTTCCTCCATG 0: 1
1: 0
2: 3
3: 43
4: 363
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007395_1102007404 6 Left 1102007395 12:109597305-109597327 CCCTCTCCAGCTGTTTCCTCCAT 0: 1
1: 0
2: 1
3: 47
4: 511
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007390_1102007404 21 Left 1102007390 12:109597290-109597312 CCCTCTGTCCCTGTCCCCTCTCC 0: 1
1: 0
2: 20
3: 235
4: 1485
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007388_1102007404 30 Left 1102007388 12:109597281-109597303 CCAGCACCTCCCTCTGTCCCTGT 0: 1
1: 1
2: 6
3: 125
4: 862
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007389_1102007404 24 Left 1102007389 12:109597287-109597309 CCTCCCTCTGTCCCTGTCCCCTC 0: 1
1: 2
2: 22
3: 292
4: 2391
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007399_1102007404 -10 Left 1102007399 12:109597321-109597343 CCTCCATGGAGCTCTTCAGCAAT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007392_1102007404 13 Left 1102007392 12:109597298-109597320 CCCTGTCCCCTCTCCAGCTGTTT 0: 1
1: 0
2: 1
3: 34
4: 463
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007394_1102007404 7 Left 1102007394 12:109597304-109597326 CCCCTCTCCAGCTGTTTCCTCCA 0: 1
1: 0
2: 5
3: 55
4: 705
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007391_1102007404 20 Left 1102007391 12:109597291-109597313 CCTCTGTCCCTGTCCCCTCTCCA 0: 1
1: 1
2: 11
3: 164
4: 1265
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221
1102007398_1102007404 0 Left 1102007398 12:109597311-109597333 CCAGCTGTTTCCTCCATGGAGCT 0: 1
1: 0
2: 1
3: 11
4: 245
Right 1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG 0: 1
1: 0
2: 1
3: 25
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102007404 Original CRISPR CTTCAGCAATGGAGGGAAAT AGG Exonic
903313590 1:22481381-22481403 CTTGAGCAATGAAAGGAAAATGG - Intronic
905907499 1:41628737-41628759 CTTCAGCACAGGTAGGAAATGGG - Exonic
906708867 1:47914644-47914666 ATTTGGCAATGGAGGGAAAGAGG - Intronic
907508171 1:54937215-54937237 CAACAGCAAAGGAGGAAAATAGG - Intergenic
908926068 1:69256565-69256587 ATTCAGTAATTGAGGGAAAGAGG + Intergenic
909087305 1:71182590-71182612 CTTCAGGAATGCAGTGAAAATGG + Intergenic
911560360 1:99398181-99398203 TTTCAGCAATGTAGGCAGATAGG + Intergenic
911569620 1:99507599-99507621 CTTCAGCAACAGAGGGAGAGGGG - Intergenic
914894348 1:151655220-151655242 CTTTAGGAATGGAGCTAAATTGG - Intronic
915532166 1:156508956-156508978 CATCAGCAGTGGAGGGAGGTGGG + Intergenic
916485325 1:165253729-165253751 CTTCAGAAAGGAAGTGAAATTGG + Intronic
916808275 1:168281169-168281191 CTTCAGGCAGGGAGGGAAAAAGG + Exonic
917166246 1:172116383-172116405 CTACAGCAGTGCAAGGAAATAGG - Intronic
917636518 1:176942491-176942513 CTTCAGAAAAGGAGGGAAAAAGG + Intronic
920564967 1:206965859-206965881 CTGCAGCAAAGGAAGGAGATGGG + Intronic
921433365 1:215088189-215088211 CTTCAGAAACCGAGGGAAGTGGG - Intronic
921456436 1:215377586-215377608 CTGCAGAATTGGAGGGAACTTGG + Intergenic
921951651 1:220936430-220936452 CTTCAGATATAGAAGGAAATTGG - Intergenic
922886132 1:229022268-229022290 CTTTAGCATTAGAGGGATATGGG + Intergenic
923062760 1:230490921-230490943 CTTGACAATTGGAGGGAAATGGG - Intergenic
924093393 1:240525372-240525394 TTTCTGGAATGAAGGGAAATGGG + Intronic
1063107088 10:3001888-3001910 CTACAGCCATGGAGGGTAAGAGG - Intergenic
1064472426 10:15650088-15650110 ATTCAGCAATGAAAAGAAATGGG + Intronic
1068167427 10:53349529-53349551 GCTCAGCAATGAAGGGAAATAGG + Intergenic
1069180572 10:65353369-65353391 GTTCAGCATTGGAAGCAAATTGG - Intergenic
1070175637 10:73967091-73967113 CTTCAGGTATGGAGGGTATTAGG + Intergenic
1070955307 10:80459743-80459765 CCACAGCAGTGGAAGGAAATGGG + Intronic
1071589873 10:86862584-86862606 CTTCAGCAATCCAGGCAAAGGGG + Intronic
1073344331 10:102770994-102771016 TTACAGAAATGGAGGCAAATGGG - Intronic
1073738188 10:106374389-106374411 CTTCTGCAATGGAAGGACAGAGG + Intergenic
1077916401 11:6614564-6614586 CTTCAGCAAAGCTGGGAAGTTGG + Exonic
1077929998 11:6721109-6721131 CTTCAGCCAAGGACGGAAATTGG - Intergenic
1077991358 11:7415089-7415111 CTTCCCCAGTGGAGGGAAATGGG + Intronic
1078314653 11:10284159-10284181 CGTCACCAGTGGAGGGAACTGGG - Intronic
1078741773 11:14073488-14073510 CTTCAGGAGGGGAGGGACATGGG - Intronic
1079710833 11:23680424-23680446 CTGCAGCTATGAAGGGAAGTGGG + Intergenic
1080528521 11:33151085-33151107 CTTAGGGATTGGAGGGAAATGGG - Intronic
1082700882 11:56429026-56429048 CTTCAGCATTTGAAGAAAATTGG + Intergenic
1087188279 11:95225897-95225919 CTTCAGCAAATAAGGGGAATTGG - Intronic
1088695973 11:112366234-112366256 CTTCAGAAATGGGGTGGAATAGG + Intergenic
1088952679 11:114587177-114587199 CTTCAACAATGAGGGGAAAAAGG + Intronic
1089018632 11:115188101-115188123 CTTCAGCAGTGGAGGGGCCTTGG - Intronic
1089695466 11:120213478-120213500 CATCAGCAAGGGAGGGAATTGGG + Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091203924 11:133805055-133805077 ATTAAGCAATGGACTGAAATTGG - Intergenic
1091724332 12:2835006-2835028 CTACAGCAATCTCGGGAAATTGG - Exonic
1091890645 12:4051549-4051571 CATGAGAAATGGAGGGCAATAGG - Intergenic
1093327495 12:17795616-17795638 CTTTAGTAATGGAGAGAACTAGG + Intergenic
1096240610 12:49958024-49958046 CTCCAGGGGTGGAGGGAAATTGG + Exonic
1097849637 12:64398976-64398998 CTTCAGCAATTGAAAGAAAAGGG + Intergenic
1099540132 12:83897763-83897785 TTTCAGCAATGGAGGGAGATGGG + Intergenic
1099837187 12:87921433-87921455 CTTCAGAAATGGAAAGAGATGGG - Intergenic
1100408193 12:94289327-94289349 AATCATCAATGGAGGGGAATTGG - Intronic
1101007812 12:100418515-100418537 GCTAAGCAATGGATGGAAATAGG - Intronic
1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG + Exonic
1102008972 12:109606583-109606605 GGTCAGCAATGGAGAGAAAACGG + Intergenic
1102216249 12:111163504-111163526 CTCCAGGAATGGAGGGACAATGG - Intronic
1103329071 12:120141310-120141332 CTTCAGTCATCCAGGGAAATTGG - Intronic
1104230912 12:126883196-126883218 CCCCAACACTGGAGGGAAATTGG - Intergenic
1105698415 13:22914518-22914540 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1105850075 13:24326757-24326779 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1108584426 13:51856894-51856916 CTTCAATAATGAAGGCAAATGGG + Intergenic
1108686076 13:52819517-52819539 CTTCAGCAAAGTATGGAATTTGG - Intergenic
1108892388 13:55277596-55277618 CGCCAGCAATGGAGTGAAACTGG - Intergenic
1112214898 13:97420021-97420043 CTTGAGGAATGGAGGCAAGTTGG + Intergenic
1113419763 13:110162053-110162075 TGTAATCAATGGAGGGAAATGGG + Intronic
1115415007 14:33122301-33122323 CTTCAGTAAAAGTGGGAAATTGG + Intronic
1115803601 14:37024843-37024865 CTTCAGAAATGGAGAAAAAAAGG + Intronic
1119720392 14:76885938-76885960 TTTCAACAATGGAAGGCAATTGG - Intergenic
1120244994 14:81995842-81995864 CTACAGAAAAGGAAGGAAATGGG - Intergenic
1120879754 14:89405892-89405914 CTTCAGAATTGGAGGGAATCGGG + Intronic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1122840022 14:104454731-104454753 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1123994173 15:25706734-25706756 CTTCTCAAATGGAGTGAAATTGG - Intronic
1128393614 15:67200837-67200859 CCTCAGCTATGCAGGGATATTGG - Intergenic
1128512748 15:68323697-68323719 CATCACCAAGGCAGGGAAATAGG - Intronic
1129135484 15:73546235-73546257 CTTCAGTGTCGGAGGGAAATGGG + Intronic
1130278097 15:82493908-82493930 CTTAAGAAATGTAGGGAAACAGG + Intergenic
1130470426 15:84221093-84221115 CTTAAGAAATGTAGGGAAACAGG + Intergenic
1130477914 15:84335660-84335682 CTTAAGAAATGTAGGGAAACAGG + Intergenic
1130493851 15:84452470-84452492 CTTAAGAAATGTAGGGAAACAGG - Intergenic
1130592714 15:85225721-85225743 CTTAAGAAATGTAGGGAAACAGG + Intergenic
1130848979 15:87775393-87775415 GTTCAGCATTTGAGGTAAATTGG + Intergenic
1130853594 15:87821380-87821402 CTTCGACAAAAGAGGGAAATGGG - Intergenic
1131053733 15:89363666-89363688 CTTAAGCCATGGAGGGGAAGAGG + Intergenic
1131396188 15:92088228-92088250 CATCAGCACTGGGGCGAAATAGG + Intronic
1132661957 16:1065622-1065644 CTTCAGCGCTGGAGAGAAATGGG + Intergenic
1133610861 16:7432065-7432087 CTTCAGCAGTGGGGGCAGATGGG + Intronic
1135583195 16:23645561-23645583 TATCAGCAATGGAAGGAAGTAGG - Intronic
1135933059 16:26755784-26755806 CTTCTGCAAGGGAGGGAATAAGG + Intergenic
1138657909 16:58501323-58501345 CTTGAGCACTGGAGGGGAGTGGG - Intronic
1139320949 16:66113488-66113510 CTTCACCAATGGGAGGAAAAGGG - Intergenic
1139367603 16:66443140-66443162 CTTCAGCAAAGGATGGATAATGG - Intronic
1139894966 16:70281186-70281208 CTTCAGCAATGGATCCAAAATGG + Intronic
1141171558 16:81694855-81694877 CCTCAGGCATGGAGGGAAAAAGG + Intronic
1144005887 17:11098498-11098520 CTTTACCAAAGGAGGGAAAGAGG - Intergenic
1148165574 17:45482074-45482096 TTTCAGTAATGGGGGTAAATTGG - Intronic
1148491207 17:48025046-48025068 TTTCAGCGAAGGAGGGAAAGTGG - Intergenic
1148588999 17:48801406-48801428 CATGAGCAATCGAGGGACATGGG + Intronic
1150396801 17:64828792-64828814 TTTCAGTAATGGGGGTAAATTGG - Intergenic
1150557470 17:66267459-66267481 CTTCTGCAATGAAGAGAATTAGG + Intergenic
1152018034 17:77764837-77764859 CTCCAGCAATGGATGGACAATGG - Intergenic
1152329765 17:79665695-79665717 CTTCAGAAATGGTAGGAAAAGGG + Intergenic
1152611744 17:81318247-81318269 CTTTAGCAAGGGAGGGAGATGGG - Intronic
1153066016 18:1045848-1045870 ATGCAGCAATGCAGGGAAAGAGG + Intergenic
1154311580 18:13271141-13271163 ATTCAGAAATGCTGGGAAATAGG + Intronic
1155549824 18:26953270-26953292 CTTCAAAAATGGATGGAAGTTGG + Intronic
1155740990 18:29287327-29287349 CTTCAGCCATTGAGAGATATGGG - Intergenic
1156197479 18:34791256-34791278 CTTGAGCATGGGAGGGAGATGGG - Intronic
1156503245 18:37572998-37573020 CTGCAGCTATGGAAGGATATAGG + Intergenic
1157052402 18:44181969-44181991 TTTAAGCAATGGAGAGTAATCGG - Intergenic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1158606275 18:58898971-58898993 TTTCAGCGCTGGAGAGAAATGGG + Intronic
1166832114 19:45645167-45645189 CTTCAGCAAGGGAGGGGGTTGGG + Intronic
1167345426 19:48942656-48942678 CTTTAGCAATGATGTGAAATTGG - Intronic
1167742651 19:51333557-51333579 CTTCTCCAAAGGAGGGAAATAGG - Intronic
1168182380 19:54671176-54671198 GTGCAGAAATGCAGGGAAATAGG - Intronic
1168598575 19:57699651-57699673 GTTCAGCATTTGAAGGAAATTGG + Exonic
925459511 2:4048286-4048308 CTTTTGTAATGGATGGAAATTGG + Intergenic
926162044 2:10495981-10496003 GTTCAGCCATGGCTGGAAATGGG - Intergenic
926311679 2:11680048-11680070 CTTCAGCAAAGAAGAGAAACTGG + Intronic
926467604 2:13210691-13210713 CTTGAGGAAAGGAGTGAAATGGG - Intergenic
926640717 2:15233233-15233255 TTCCAGCAATGGAAGGAAAAGGG - Intronic
930381946 2:50641302-50641324 CAGCAGCAAATGAGGGAAATGGG - Intronic
932622292 2:73271929-73271951 CTTAAGCAAAAAAGGGAAATAGG - Intronic
933408016 2:81887594-81887616 GTTAAGGACTGGAGGGAAATGGG - Intergenic
933986178 2:87594089-87594111 CTCCAGCAAGGGAGGGAGAAGGG + Intergenic
935130989 2:100260871-100260893 CCTCAGGAATGGAGGGACTTCGG - Intergenic
935188998 2:100760835-100760857 CTTCAGAAATAGGAGGAAATGGG - Intergenic
935461932 2:103347062-103347084 CTACAGCCATGGAAGGAAATGGG - Intergenic
936307657 2:111356714-111356736 CTCCAGCAAGGGAGGGAAAAGGG - Intergenic
938085907 2:128401996-128402018 CTGCTGAAAGGGAGGGAAATGGG + Intergenic
941683934 2:168428471-168428493 AATCAGCAATGGAAGGAAAAAGG - Intergenic
941831446 2:169965116-169965138 CTTGAGCAATGGGTGAAAATGGG - Intronic
942091621 2:172497181-172497203 ATTCAGCAATGGAAAGAAAAGGG - Intronic
942763144 2:179424043-179424065 CTTGAGAAATGGAGAGAATTAGG - Intergenic
943741148 2:191410440-191410462 CTTCAGGGATGGAGTGAAAGGGG + Intronic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
945013271 2:205487313-205487335 CTTCCCCAATGGAGGGTATTGGG - Intronic
945169072 2:206977157-206977179 CTTCAGGTCTGCAGGGAAATTGG - Intergenic
947497870 2:230651797-230651819 CTTCAGCTATGACAGGAAATAGG - Intergenic
948584579 2:239011466-239011488 CTTCATCCATGGAGGGTACTGGG + Intergenic
1169809238 20:9592656-9592678 CTTCTGCAAAGGTGGGACATTGG + Intronic
1169861524 20:10158033-10158055 CTTAAGCAAAGGAGCTAAATCGG - Intergenic
1169941777 20:10945619-10945641 CTTCACCACTGGAGAGAAATGGG + Intergenic
1173911360 20:46673408-46673430 CCCCAGCAATGGAAGGGAATGGG - Intronic
1177033990 21:16019113-16019135 CTTCAGCAATGGATGGTATTAGG + Intergenic
1180752856 22:18137092-18137114 GCTCAGAGATGGAGGGAAATAGG + Intronic
1181301976 22:21886922-21886944 TTTCAGCAATGGAAGGACATTGG + Intergenic
1182004445 22:26948071-26948093 CTGCTGCAATGGAAGAAAATGGG - Intergenic
1183037523 22:35151338-35151360 CTTCAGATATGGAGAGAAAGAGG - Intergenic
1184253749 22:43275677-43275699 CTCCAGGAAGGGAGGGGAATGGG + Intronic
949312099 3:2711494-2711516 CTTCAGAAAAGTAGGGAATTTGG - Intronic
949694037 3:6673644-6673666 ATTCAGCATTTGAGGCAAATTGG + Intergenic
949720978 3:6990049-6990071 CTTCAGGAAGGGAGGGATATAGG - Intronic
953370324 3:42382223-42382245 GTTGAGCAAGGGAGAGAAATGGG - Intergenic
953824327 3:46236833-46236855 CTTCAGCAGAGGAGGGAAAGGGG + Intronic
955572872 3:60326800-60326822 CTTCAGCAATGGGGAGATGTGGG - Intronic
956490267 3:69763815-69763837 CTTCAGAGATGGAGCGGAATAGG - Intronic
958004122 3:87791563-87791585 CTTCACCAATGGAAGGAAGGTGG + Intergenic
958262413 3:91397206-91397228 CTTCAAAAATGGAGAGAAAAGGG - Intergenic
958425374 3:93973374-93973396 CTTCAGCTTTGAAGGGAAATGGG + Intronic
958598311 3:96259842-96259864 CATCAGCAACGTGGGGAAATAGG + Intergenic
960162105 3:114361732-114361754 CTTCTGCATTTGAGGGAAAGTGG - Intronic
960981828 3:123236037-123236059 CTAGAGGAATGGAGGGAAATAGG + Intronic
962035919 3:131651397-131651419 CTTCAGTAATGAAAGGAAAAAGG - Intronic
963008668 3:140749729-140749751 CTTCAGCAAGGGTGGGAGAGAGG - Intergenic
965391898 3:168115011-168115033 CTTGAACAATGAAGTGAAATGGG + Intergenic
965787452 3:172351155-172351177 GTACAGCAAAGAAGGGAAATAGG + Intronic
965920481 3:173907448-173907470 CTACAGAAATGTAGGGAAATAGG - Intronic
971693450 4:29867443-29867465 TTCCAGCAATGGAGGAAACTTGG + Intergenic
971835037 4:31751794-31751816 CTTCAGGAATTGAAGGAATTGGG - Intergenic
972776996 4:42250551-42250573 CATCATCAAAGGAGGGAAAGAGG + Intergenic
972827338 4:42774966-42774988 CTTGAGCGATGGAGATAAATGGG + Intergenic
973573536 4:52263896-52263918 CCTCAGCAGTGGTGGGAATTTGG + Intergenic
973866247 4:55116782-55116804 CTTCAGCAATGGATGGAGCCAGG - Intronic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
982758150 4:159249327-159249349 ATTCAGCACTGGCAGGAAATAGG - Intronic
983514718 4:168644046-168644068 CTTCATCACTGGAAGCAAATGGG - Intronic
984197481 4:176676598-176676620 CTTCAATAATGGAGGGATATTGG - Intergenic
988399742 5:30747516-30747538 CTGTGGCAATAGAGGGAAATAGG - Intergenic
988830135 5:34978927-34978949 ATTCAGCACTGGAGGGAAAGTGG + Intergenic
991071311 5:62484697-62484719 CTTAAGCTATGGTGGGACATAGG + Intronic
991408943 5:66328132-66328154 CTTCAGGTATGTAAGGAAATTGG - Intergenic
991860994 5:71013164-71013186 CTTCATGAATGGAGGCAGATGGG - Intronic
992762896 5:79967100-79967122 CTTGAGCAATGGAGCGATACAGG + Intergenic
993078109 5:83261282-83261304 CTTCAGGAAGGGAGGAAAATAGG - Intronic
993693057 5:91026564-91026586 TTTCAGTTATGGAGGGAAAGTGG + Intronic
994228258 5:97280839-97280861 ATTCAGCAATGAAATGAAATGGG + Intergenic
995173460 5:109144678-109144700 CTCCAAGAATGGAGGGAAACTGG - Intronic
995209701 5:109523364-109523386 CATCAACAATGGAAGGAAACAGG - Intergenic
999153877 5:149444202-149444224 CTTCAGCACTGGAGGGTCCTGGG - Intergenic
999362468 5:150997637-150997659 CTTTGGAAATTGAGGGAAATTGG - Intergenic
999666805 5:153921287-153921309 CTTCATAAATGAAGGGAAATGGG - Intergenic
1000077042 5:157800462-157800484 ATTCAGCAGTGAAAGGAAATTGG - Intronic
1001935543 5:175701048-175701070 GATAAGCAGTGGAGGGAAATGGG + Intergenic
1002759665 6:191760-191782 CTTTAGCAATGGAAGGTCATTGG + Intergenic
1003169432 6:3709477-3709499 CTTGAGCAATGTAGGGAAGCAGG + Intergenic
1008604461 6:53127036-53127058 CTTCAGCAAAGAAGAGAAACTGG + Exonic
1008993005 6:57625671-57625693 CTTCAAAAATGGAGAGAAAAGGG + Intronic
1009181619 6:60524776-60524798 CTTCAAAAATGGAGAGAAAAGGG + Intergenic
1009490901 6:64289444-64289466 CTCCTGCCATAGAGGGAAATTGG - Intronic
1016010218 6:139131725-139131747 CTTCAGAAATGGTGGGAAAACGG + Intergenic
1016508553 6:144813516-144813538 CTTTACCAATGGAAGGAAAATGG - Intronic
1017569582 6:155730635-155730657 CATATGCAATGGAGGGAAATAGG + Intergenic
1021008840 7:15436767-15436789 CTTCAGAAATGGAGGTGACTGGG + Intronic
1024515306 7:50247587-50247609 CTTCACCTATGGATGGACATGGG - Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1026687328 7:72522433-72522455 ATTCATCAATGGAGGAAAATAGG + Intergenic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028474078 7:91234721-91234743 TTTTATTAATGGAGGGAAATTGG - Intergenic
1031057439 7:117008643-117008665 CATCAGAAATGAAGGGAATTGGG + Intronic
1031593544 7:123621950-123621972 CATCAGGAATGGAGGGCAGTGGG - Intronic
1031698647 7:124894704-124894726 TGTCAGCAAGGGAGGCAAATTGG - Intronic
1031945696 7:127837951-127837973 CTTCAACAAGGGAGGGGAACAGG + Intronic
1032693452 7:134312743-134312765 CTTTAGAAATGGAATGAAATGGG - Intronic
1036429910 8:8680681-8680703 ATTCGGCAATGGCGGCAAATGGG - Intergenic
1037569539 8:20147005-20147027 CTTCAGTAGAGAAGGGAAATGGG - Intronic
1038528298 8:28295993-28296015 CTTGAGGAATGGAGGGGAGTAGG - Intergenic
1041561422 8:59223725-59223747 CTTCAGAAAGGGAGGAAAAAGGG - Intergenic
1042577680 8:70238912-70238934 TTGCAGATATGGAGGGAAATGGG - Intronic
1042836640 8:73085081-73085103 CTCCAGCAAAGGAAGGAAGTGGG + Intronic
1044713857 8:95082340-95082362 GTGCAGCAATGGTAGGAAATGGG + Intronic
1045544443 8:103115752-103115774 CTTGGGCAATAGAGGGAAACTGG + Intergenic
1045811920 8:106231719-106231741 CTTCAGAAATGCAGCAAAATAGG - Intergenic
1055033479 9:71793727-71793749 CCTGAGTACTGGAGGGAAATGGG + Intronic
1059547909 9:115197324-115197346 CTACAGCCATGTAGGGAGATGGG - Intronic
1060343643 9:122798341-122798363 CTTAACCAATGGAGGAAAAAAGG + Intergenic
1061246625 9:129404134-129404156 CTGCAGCAGTGGAGGGACAGAGG + Intergenic
1186154431 X:6710855-6710877 CTCCAGCTATGGAGGAAAACTGG - Intergenic
1186684111 X:11906446-11906468 CTTTGAAAATGGAGGGAAATTGG - Intergenic
1186687895 X:11944720-11944742 CTCGAGCAATGGTGGCAAATAGG + Intergenic
1188177539 X:27010259-27010281 GTTCAGCATTTGAGGCAAATTGG - Intergenic
1188212649 X:27443253-27443275 CTTAAACAAGGGAGGGAAAAAGG + Intergenic
1188945077 X:36290611-36290633 GTTCAGAGATGGAGGGAATTTGG + Intronic
1189174450 X:38941186-38941208 CTTCAGCATTGGAGGTCAGTAGG - Intergenic
1189331809 X:40148770-40148792 CATTGGCAAAGGAGGGAAATGGG + Intronic
1189925657 X:45951808-45951830 CTTCAGAGGTGGAGGGATATTGG + Intergenic
1195348604 X:103976058-103976080 CTTCAGCACCCGGGGGAAATAGG - Intergenic
1195355954 X:104040161-104040183 CTTCAGCACCCGGGGGAAATAGG - Exonic
1195358838 X:104062782-104062804 CTTCAGCACCCGGGGGAAATAGG + Intergenic
1197592548 X:128426265-128426287 ATTCAGCCATGCAGAGAAATAGG - Intergenic
1197631576 X:128867152-128867174 CTTCAGAAATAGAGTGAACTAGG + Intergenic
1198126747 X:133652114-133652136 CTTCAATAAGGGATGGAAATTGG - Intronic
1198310366 X:135423000-135423022 CCTGAGGAATGGAGGGTAATGGG + Intergenic
1200407377 Y:2826942-2826964 CTTCAGAAAAGGAGAGAATTGGG + Intergenic
1200923217 Y:8631467-8631489 CTTGTGCAATGAAGGGAATTTGG - Intergenic
1201255868 Y:12107775-12107797 CTACAGCCATGGTGGGAAACAGG - Intergenic