ID: 1102009282

View in Genome Browser
Species Human (GRCh38)
Location 12:109608043-109608065
Sequence GACCCAGCAAACCCCTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102009282_1102009286 -10 Left 1102009282 12:109608043-109608065 CCTCCAAAGGGGTTTGCTGGGTC No data
Right 1102009286 12:109608056-109608078 TTGCTGGGTCTTGGAATAGGTGG No data
1102009282_1102009287 -7 Left 1102009282 12:109608043-109608065 CCTCCAAAGGGGTTTGCTGGGTC No data
Right 1102009287 12:109608059-109608081 CTGGGTCTTGGAATAGGTGGAGG No data
1102009282_1102009288 -2 Left 1102009282 12:109608043-109608065 CCTCCAAAGGGGTTTGCTGGGTC No data
Right 1102009288 12:109608064-109608086 TCTTGGAATAGGTGGAGGTCAGG No data
1102009282_1102009291 20 Left 1102009282 12:109608043-109608065 CCTCCAAAGGGGTTTGCTGGGTC No data
Right 1102009291 12:109608086-109608108 GTGCTGGTCCAAAGCAGGTGTGG No data
1102009282_1102009290 15 Left 1102009282 12:109608043-109608065 CCTCCAAAGGGGTTTGCTGGGTC No data
Right 1102009290 12:109608081-109608103 GTCAGGTGCTGGTCCAAAGCAGG No data
1102009282_1102009289 4 Left 1102009282 12:109608043-109608065 CCTCCAAAGGGGTTTGCTGGGTC No data
Right 1102009289 12:109608070-109608092 AATAGGTGGAGGTCAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102009282 Original CRISPR GACCCAGCAAACCCCTTTGG AGG (reversed) Intergenic
No off target data available for this crispr