ID: 1102010521

View in Genome Browser
Species Human (GRCh38)
Location 12:109615774-109615796
Sequence CTGGCTGAGGATTCTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102010506_1102010521 20 Left 1102010506 12:109615731-109615753 CCCTGCTACATCCAGAGCAGTGC No data
Right 1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG No data
1102010507_1102010521 19 Left 1102010507 12:109615732-109615754 CCTGCTACATCCAGAGCAGTGCC No data
Right 1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG No data
1102010513_1102010521 -2 Left 1102010513 12:109615753-109615775 CCAGGACAGCTGGCGGGAGTCCT No data
Right 1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG No data
1102010504_1102010521 29 Left 1102010504 12:109615722-109615744 CCCGGTGTTCCCTGCTACATCCA No data
Right 1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG No data
1102010509_1102010521 9 Left 1102010509 12:109615742-109615764 CCAGAGCAGTGCCAGGACAGCTG No data
Right 1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG No data
1102010505_1102010521 28 Left 1102010505 12:109615723-109615745 CCGGTGTTCCCTGCTACATCCAG No data
Right 1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102010521 Original CRISPR CTGGCTGAGGATTCTGGAGG GGG Intergenic
No off target data available for this crispr