ID: 1102010829

View in Genome Browser
Species Human (GRCh38)
Location 12:109617381-109617403
Sequence CTCCCAAGGAGCTCTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102010829_1102010833 3 Left 1102010829 12:109617381-109617403 CCTGAAACAGAGCTCCTTGGGAG No data
Right 1102010833 12:109617407-109617429 CAAGGATGTCAGACACGCCTGGG No data
1102010829_1102010832 2 Left 1102010829 12:109617381-109617403 CCTGAAACAGAGCTCCTTGGGAG No data
Right 1102010832 12:109617406-109617428 GCAAGGATGTCAGACACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102010829 Original CRISPR CTCCCAAGGAGCTCTGTTTC AGG (reversed) Intergenic
No off target data available for this crispr