ID: 1102010833

View in Genome Browser
Species Human (GRCh38)
Location 12:109617407-109617429
Sequence CAAGGATGTCAGACACGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102010829_1102010833 3 Left 1102010829 12:109617381-109617403 CCTGAAACAGAGCTCCTTGGGAG No data
Right 1102010833 12:109617407-109617429 CAAGGATGTCAGACACGCCTGGG No data
1102010825_1102010833 12 Left 1102010825 12:109617372-109617394 CCCAGCACTCCTGAAACAGAGCT No data
Right 1102010833 12:109617407-109617429 CAAGGATGTCAGACACGCCTGGG No data
1102010826_1102010833 11 Left 1102010826 12:109617373-109617395 CCAGCACTCCTGAAACAGAGCTC No data
Right 1102010833 12:109617407-109617429 CAAGGATGTCAGACACGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102010833 Original CRISPR CAAGGATGTCAGACACGCCT GGG Intergenic
No off target data available for this crispr