ID: 1102011019

View in Genome Browser
Species Human (GRCh38)
Location 12:109618430-109618452
Sequence AAAGCTTCCAAGACCCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102011019_1102011026 2 Left 1102011019 12:109618430-109618452 CCAATCTGGGTCTTGGAAGCTTT No data
Right 1102011026 12:109618455-109618477 CTGGGCAGCAGCCTGGGGTGTGG No data
1102011019_1102011028 9 Left 1102011019 12:109618430-109618452 CCAATCTGGGTCTTGGAAGCTTT No data
Right 1102011028 12:109618462-109618484 GCAGCCTGGGGTGTGGGAAGTGG No data
1102011019_1102011023 -4 Left 1102011019 12:109618430-109618452 CCAATCTGGGTCTTGGAAGCTTT No data
Right 1102011023 12:109618449-109618471 CTTTGCCTGGGCAGCAGCCTGGG No data
1102011019_1102011027 3 Left 1102011019 12:109618430-109618452 CCAATCTGGGTCTTGGAAGCTTT No data
Right 1102011027 12:109618456-109618478 TGGGCAGCAGCCTGGGGTGTGGG No data
1102011019_1102011024 -3 Left 1102011019 12:109618430-109618452 CCAATCTGGGTCTTGGAAGCTTT No data
Right 1102011024 12:109618450-109618472 TTTGCCTGGGCAGCAGCCTGGGG No data
1102011019_1102011022 -5 Left 1102011019 12:109618430-109618452 CCAATCTGGGTCTTGGAAGCTTT No data
Right 1102011022 12:109618448-109618470 GCTTTGCCTGGGCAGCAGCCTGG No data
1102011019_1102011029 10 Left 1102011019 12:109618430-109618452 CCAATCTGGGTCTTGGAAGCTTT No data
Right 1102011029 12:109618463-109618485 CAGCCTGGGGTGTGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102011019 Original CRISPR AAAGCTTCCAAGACCCAGAT TGG (reversed) Intergenic
No off target data available for this crispr