ID: 1102013045

View in Genome Browser
Species Human (GRCh38)
Location 12:109630820-109630842
Sequence GAGGGGAATATACAGAGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102013040_1102013045 2 Left 1102013040 12:109630795-109630817 CCGTGCTGACAGCTGGGAGTGGC No data
Right 1102013045 12:109630820-109630842 GAGGGGAATATACAGAGGATAGG No data
1102013034_1102013045 25 Left 1102013034 12:109630772-109630794 CCTCCTGGGTGGTGAGGGAAGGG No data
Right 1102013045 12:109630820-109630842 GAGGGGAATATACAGAGGATAGG No data
1102013036_1102013045 22 Left 1102013036 12:109630775-109630797 CCTGGGTGGTGAGGGAAGGGCCG No data
Right 1102013045 12:109630820-109630842 GAGGGGAATATACAGAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102013045 Original CRISPR GAGGGGAATATACAGAGGAT AGG Intergenic
No off target data available for this crispr