ID: 1102014735

View in Genome Browser
Species Human (GRCh38)
Location 12:109640477-109640499
Sequence ATGCAGTTAGTGACTAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102014733_1102014735 0 Left 1102014733 12:109640454-109640476 CCAGGCTGCATTTTACTTGAGAC No data
Right 1102014735 12:109640477-109640499 ATGCAGTTAGTGACTAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102014735 Original CRISPR ATGCAGTTAGTGACTAAACA GGG Intergenic
No off target data available for this crispr