ID: 1102015277

View in Genome Browser
Species Human (GRCh38)
Location 12:109644280-109644302
Sequence GACTTTGTGGGGGTTTGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102015277_1102015284 -7 Left 1102015277 12:109644280-109644302 CCTATTCAAACCCCCACAAAGTC No data
Right 1102015284 12:109644296-109644318 CAAAGTCACCCCCATTTCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 195
1102015277_1102015294 24 Left 1102015277 12:109644280-109644302 CCTATTCAAACCCCCACAAAGTC No data
Right 1102015294 12:109644327-109644349 CTGCATCTTCAACTCCTAGGTGG 0: 1
1: 0
2: 1
3: 18
4: 147
1102015277_1102015283 -8 Left 1102015277 12:109644280-109644302 CCTATTCAAACCCCCACAAAGTC No data
Right 1102015283 12:109644295-109644317 ACAAAGTCACCCCCATTTCTGGG 0: 1
1: 0
2: 3
3: 22
4: 171
1102015277_1102015282 -9 Left 1102015277 12:109644280-109644302 CCTATTCAAACCCCCACAAAGTC No data
Right 1102015282 12:109644294-109644316 CACAAAGTCACCCCCATTTCTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1102015277_1102015291 21 Left 1102015277 12:109644280-109644302 CCTATTCAAACCCCCACAAAGTC No data
Right 1102015291 12:109644324-109644346 TCCCTGCATCTTCAACTCCTAGG 0: 1
1: 0
2: 19
3: 180
4: 1351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102015277 Original CRISPR GACTTTGTGGGGGTTTGAAT AGG (reversed) Intergenic
No off target data available for this crispr