ID: 1102019425

View in Genome Browser
Species Human (GRCh38)
Location 12:109671403-109671425
Sequence TCACTTCTGGACTTAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102019425_1102019427 -4 Left 1102019425 12:109671403-109671425 CCAGGCTCTAAGTCCAGAAGTGA No data
Right 1102019427 12:109671422-109671444 GTGATAGCTTGTGACTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102019425 Original CRISPR TCACTTCTGGACTTAGAGCC TGG (reversed) Intergenic
No off target data available for this crispr