ID: 1102022210

View in Genome Browser
Species Human (GRCh38)
Location 12:109691488-109691510
Sequence CTGGCCTATTTGTTTTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102022201_1102022210 23 Left 1102022201 12:109691442-109691464 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022194_1102022210 29 Left 1102022194 12:109691436-109691458 CCCCCCCCTCAGCCTCCCAAAGT 0: 93
1: 1245
2: 3689
3: 5410
4: 6634
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022198_1102022210 25 Left 1102022198 12:109691440-109691462 CCCCTCAGCCTCCCAAAGTGCTG 0: 1297
1: 3032
2: 4060
3: 4073
4: 3818
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022203_1102022210 17 Left 1102022203 12:109691448-109691470 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022204_1102022210 14 Left 1102022204 12:109691451-109691473 CCCAAAGTGCTGGGATTACAGAT 0: 5300
1: 89088
2: 313361
3: 241102
4: 147967
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022199_1102022210 24 Left 1102022199 12:109691441-109691463 CCCTCAGCCTCCCAAAGTGCTGG 0: 1435
1: 3422
2: 4607
3: 5142
4: 5378
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022195_1102022210 28 Left 1102022195 12:109691437-109691459 CCCCCCCTCAGCCTCCCAAAGTG 0: 87
1: 1162
2: 3521
3: 5002
4: 5776
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022205_1102022210 13 Left 1102022205 12:109691452-109691474 CCAAAGTGCTGGGATTACAGATG 0: 5024
1: 81336
2: 213729
3: 253622
4: 203117
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022196_1102022210 27 Left 1102022196 12:109691438-109691460 CCCCCCTCAGCCTCCCAAAGTGC 0: 1029
1: 96197
2: 221028
3: 243706
4: 259176
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022193_1102022210 30 Left 1102022193 12:109691435-109691457 CCCCCCCCCTCAGCCTCCCAAAG 0: 492
1: 47212
2: 143572
3: 184405
4: 168590
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data
1102022197_1102022210 26 Left 1102022197 12:109691439-109691461 CCCCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1102022210 12:109691488-109691510 CTGGCCTATTTGTTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102022210 Original CRISPR CTGGCCTATTTGTTTTGAGA TGG Intergenic
No off target data available for this crispr