ID: 1102023483

View in Genome Browser
Species Human (GRCh38)
Location 12:109699794-109699816
Sequence CAATTAGGCCAGAAGCCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1102023483_1102023486 -7 Left 1102023483 12:109699794-109699816 CCTGATGGCTTCTGGCCTAATTG No data
Right 1102023486 12:109699810-109699832 CTAATTGCCAGCAAACCCCAGGG No data
1102023483_1102023485 -8 Left 1102023483 12:109699794-109699816 CCTGATGGCTTCTGGCCTAATTG No data
Right 1102023485 12:109699809-109699831 CCTAATTGCCAGCAAACCCCAGG No data
1102023483_1102023488 1 Left 1102023483 12:109699794-109699816 CCTGATGGCTTCTGGCCTAATTG No data
Right 1102023488 12:109699818-109699840 CAGCAAACCCCAGGGAGCTGTGG No data
1102023483_1102023492 24 Left 1102023483 12:109699794-109699816 CCTGATGGCTTCTGGCCTAATTG No data
Right 1102023492 12:109699841-109699863 CTGCTTCATGCTACCTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1102023483 Original CRISPR CAATTAGGCCAGAAGCCATC AGG (reversed) Intergenic
No off target data available for this crispr